Computational protocol: Expression and localization of forkhead transcriptional factor 2 (Foxl2) in the gonads of protogynous wrasse, Halichoeres trimaculatus

Similar protocols

Protocol publication

[…] The total RNA was extracted using the RNeasy mini kit with RNase-free DNase kit (Qiagen, Venlo, the Netherlands) according to the manufacturer's protocols. The RNA concentration was measured using a NanoDrop spectrometer. RNA samples were used for cloning and rtq PCR assay.One microgram of total RNA from the ovary was reverse-transcribed using an oligo (dT) primer and Superscript II reverse transcriptase (Invitrogen, CA, USA) according to the manufacturer's instructions. RT-PCR was performed using degenerate primers (dn Foxl2-F1: gagaagmgbctyacgctgtccgg, dn Foxl2-R1: cccartawgagcartgcatcat) designed from the conserved regions of known Foxl2 sequences from other vertebrates. The amplicon was T-A ligated into pGEM-T-Easy vector (Promega, WI, USA) and sequenced. Based on the sequence information of the partial complimentary DNA (cDNA) of Foxl2, rapid amplification of cDNA ends (RACE) procedures were performed in order to isolate the 5' and 3' ends of the cDNA (SMART cDNA library construction Kit; Takara, Shiga, Japan). The initial PCR amplification in each RACE procedure was followed by a nested PCR. Gene-specific primer (GSP) sets (5' RACE: 5GSP1; accaggagttgttcatgaagctggact, 5GSP2; tagttccccttctcaaacatgtcctca, 3'RACE: 3GSP1; agtccagcttcatgaacaactcctggtcg, 3GSP2; atccccaccatgcccagcagctgagcccg) were used in combination with adaptor primers. Finally, the open reading frame (ORF) of the wrasse Foxl2 was generated from ovarian RNA by RT-PCR with primers targeting the untranslated regions immediately upstream (actagcatttggactggagttg) and downstream (ttttgaaatcacaggaatcag) to the ORF. The final PCR product was subcloned and sequenced in both directions. The PCR cycle conditions were 30 cycles, with 94°C for 15 s, 50°C for 30 s and 72°C for 30 s.Alignment of the amino acid sequences of Foxl2 from different species was performed using the ClustalW sequence alignment program. Homology value (percentage of amino acid sequence identity) was calculated by pair wise alignment. The phylogenetic tree was constructed using neighbour-joining (NJ) method [] and viewed with TreeViewX (Version 0.5.0). Details of the program settings are given in the legend for Figure . […]

Pipeline specifications

Software tools Clustal W, TreeViewX
Application Phylogenetics
Organisms Halichoeres trimaculatus
Diseases Precancerous Conditions