Computational protocol: PARP-1 Expression is Increased in Colon Adenoma and Carcinoma and Correlates with OGG1

Similar protocols

Protocol publication

[…] Specimens were examined with light microscope (Eclipse E800, Nikon) equipped with cooled CD camera (Nikon Digital Sight DS-5Mc, Germany) driven by NIS Elements F 3.0 software (Nikon, Germany). The expression levels of antigens were evaluated by staining intensity of the cell's compartments after immunohistochemical detection of the analyzed antigens using the method described by Remmele and Stegner . That scoring system (IRS) took into account the intensity of the colour reaction (SI) and the percentage of positive cells (PP) within the five microscope fields at the magnification of 200 x. The final score represented a product of scores (SI × PP) and ranged from 0 to 12 points (low reaction: 1 to 2 points, average reaction: 3 to 4 points, intense reaction: 6 to 12 points). The images were prepared using CorelDraw12 software. [...] Real-time PCR assays were carried out on a Roche LightCycler480 System apparatus. Each reaction was carried out in 10 µl mixture of the AmpliQ Real-Time PCR SYBR Green KIT containing: 1× Taq polymerase buffer (without MgCl2), 3 mM MgCl2, 0.01% Tween 20, 0.8% glycerol, 5% DMSO, 0.5 ng/µl acetylated BSA, dATP, dCTP, dGTP and dTTP – 400 µM each, 1× concentrated reference dye ROX, 1∶40000 diluted SYBR Green, 0.625 U of Taq polymerase, forward and reverse primers, 400 µM each, and cDNA template. The time -temperature program was as follows: 95°C for 3 min as initial denaturation step followed by 45 cycles consisting of a denaturation step at 95°C for 15 s, primer annealing at 60°C for 15 s and an extension step at 72°C for 1 min. Fluorescence was read during the extension step of each cycle. Melting-point temperature analysis was performed in the range of 60 to 95°C, with temperature increments of 0.33°C. Background range and threshold for Ct evaluation in each experiment were adjusted manually.The primers were designed using the Primer Express program (Applied Biosystems; Foster City, CA, USA). The following PCR sense and antisense primers (sequence 5'->3' respectively) were used: PARP-1 (TCAGCCTCCTTGCTACAGAGG and GGTCGTTCTGAGCCTTTAGGG), OGG1 (CAGCTCCACTGCACTGTGTACC and TCGCACACCTTGGAATTTCTG), c-MYC (CCTACCCTCTCAACGACAG and TCTTGTTCCTCCTCAGAGTC), PMM1 (CGCCTTCCTGCAGAAGCTAC and TCTGCTTGGAGAGCAGTCGTC), RPII (TTGGCTTCAAGCACCGGAC and ATCCAGTCTCAGCAGTCTTGACAG).Before use the primers were tested for equal efficiency of the PCR reaction by the 2-ΔΔCt method validation . Each experiment involved measurement of Ct values for three amounts of the template, each in duplicate. The template amounts per sample were as follows: 30, 120 and 480 ng for all the genes. The efficiency (values between 0 and 1) of the qPCR reaction with each primer pair was calculated, and subsequently used to calculate the ratio of each studied gene to the reference gene. Only efficiency values ≥0.95 were accepted.For each cDNA sample four reactions were carried out using two template amounts of 10 and 40 ng, each in duplicate. The quality of results was evaluated on the basis of expected Ct differences between the two cDNA amounts as well as product melting curves. A few rare outlying results were omitted in the calculations. For each gene the amounts of cDNA were chosen individually (if possible, the same for all genes) to obtain Ct values in the range between 14 and 34 cycles.The results were calculated with normalization of Ct values to mean Ct value for the PMM1 and RPII reference genes as described . [...] To summarize the data the following descriptive statistics: median, first quartile (Q1), third quartile (Q3), minimum and maximum values, were calculated for each quantitative variable. The resulting groups comprised similar number of patients.For the statistical analysis the STATISTICA (version 10.0) computer software (StatSoft, Inc) was used. For normal distribution, variables were analyzed by the Kolmogorov–Smirnov test with Lillefor's correction. For variables with non-parametric distribution U Mann–Whitney's test was carried out; for variables with normal distribution - Student-t test. Statistical significance was considered at p<0.05. […]

Pipeline specifications

Software tools CorelDraw, Primer Express, Statistica
Applications Miscellaneous, qPCR
Organisms Homo sapiens
Diseases Adenoma, Carcinoma, Colonic Neoplasms