Computational protocol: Microbial Community Analysis of Colored Snow from an Alpine Snowfield in Northern Japan Reveals the Prevalence of Betaproteobacteria with Snow Algae

Similar protocols

Protocol publication

[…] For cell collection for DNA extraction, ∼1 L volume of snow was melted overnight during the first night after sampling at 4°C. Once the snow melted, 150 ml volumes were passed through Sterivex filters (SVGPL10RC) to collect cells and these filters were stored at -20°C. DNA was extracted using the PowerWater sterivex DNA isolation Kit (Mo Bio Laboratories) following the manufacturer’s instructions, leading to a total of approximately 0.5–1 μg of DNA extracted per filter. 16S rRNA gene was amplified over the V3–V4 hypervariable region using the following primer pair 341F (5′ CCTACGGGNGGCWGCAG) and 805R (5′ GACTACHVGGGTATCTAATCC) (; ). The 18S rRNA gene was amplified over the V4–V5 hypervariable region using the primer pair 528F (5′ GCGGTAATTCCAGCTCCAA) and 706R (5′ AATCCRAGAATTTCACCTCT) (; ). All primers were tagged with the Illumina Nextera Transposase adapter sequences on the 5′ end of the primers (forward adapter: 5′ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG; reverse adapter: 5′ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG). For Polymerase Chain Reaction (PCR) gene amplification, KAPA HiFi HotStart ReadyMix polymerase was used with 12.5 ng of total DNA per reaction with 0.2 μM final concentration of each primer in a 25 μl reaction volume. For the 16S rRNA gene amplification, the initial denaturation was at 95°C for 5 min, followed by 25 cycles of 30 s at 95°C, 30 s at 50°C, 30 s at 72°C, with the final extension at 72°C for 5 min. 18S rRNA gene amplification was carried out as in with the initial denaturation at 95°C for 5 min, followed by 30 cycles of 30 s at 95°C, 30 s at 60°C, 30 s at 72°C, and the final extension at 72°C for 7 min. PCR products were purified using the QIAquick PCR purification kit (Qiagen). Purified PCR product was submitted for quality analysis and Illumina MiSeq sequencing at a sequencing facility (Hokkaido Systems Science Co., Ltd., Sapporo, Japan). QIIME was used to cleanup and assign operational taxonomic units (OTUs) from raw sequencing data (). Sequence cleanup was performed by trimming sequences after an ambiguous base and when the quality score fell below 25 in a sliding window of 50 bp. Fastq-join was used with the default settings (minimum 6 bp overlap and an 8% maximum mismatch) (). Sequences not in the 200–1000 bp range as well as sequences containing homopolymers (8 bp or longer) were removed. Sequences were filtered for the presence of the forward primers (1 mismatch allowed), followed by the trimming of the forward and reverse primers. OTUs were picked from the quality-filtered sequences using the UCLUST method with a similarity threshold of 97% (). For the 18S rRNA gene fragment analysis, at least 100 reads were required for the picked OTUs and sequences were aligned using SINA with the SILVA database (). Default settings were used with the minimum identity threshold set to 0.9. For the 16S rRNA gene fragment analysis, the QIIME annotation program was used with the 16S rRNA gene database (greengenes version 13_8 database) with a minimum identity threshold of 0.9 (). The representative 16S rRNA OTUs were subjected to chimera-checking using QIIME ChimeraSlayer program.For sequencing of 18S rRNA gene of isolated Chloromonas strains, DNA was extracted from 1 ml of liquid culture using phenol-chloroform as described previously (). Primer pair E4F (5′ CTGGTTGATTCTGCCAGT) and E1628R (5′ CGACGGGCGGTGTGTA) was used for PCR amplification of 18S rRNA gene (; ). Primers E4F, 528F, 706R, and 1628R were used for sequencing the gene fragment in addition to custom primers to read the gaps and ends of the amplicon: C1_F1 (5′ GACCGGAGTAATGATTAAGAG), C1_F2 (5′ ACTATTGTCGTTTAGGCAATG), C1_R1 (5′ GAATTACTACGGTTATCCGAG), and C1_R2 (5′ GGGCAGAAATTTGAATGAAAC).The 16S and 18S rRNA gene fragment sequences obtained by MiSeq analysis have been submitted to NCBI Sequence Read Archive (SRA) database under the accession No. SRR5482949-SRR5482956. The 18S rRNA gene fragment of the Chloromonas sp. AsaC1 strain has been deposited in GenBank under the accession number KY993906. […]

Pipeline specifications

Software tools QIIME, ea-utils, UCLUST, ChimeraSlayer
Application 16S rRNA-seq analysis
Chemicals Carbon