Computational protocol: Zinc Deficiency‐Like Syndrome in Fleckvieh Calves: Clinical and Pathological Findings and Differentiation from Bovine Hereditary Zinc Deficiency

Similar protocols

Protocol publication

[…] Archive cases of Fleckvieh calves under the age of 8 months with a history of crusting dermatitis or suspected zinc deficiency were identified (1988–2008) and the histology reviewed. For genomic DNA isolation, 10 µm sections of these archival formalin‐fixed paraffin‐embedded (FFPE) tissue samples were deparaffinized 3 × 20 minutes in xylene and rehydrated in a graded ethanol series for 2 × 15 minutes. After, sections were incubated overnight in 1x PK‐buffer (20 mM Tris‐HCl, 4 mM EDTA, 100 mM NaCl), 10% SDS and 2 µL Proteinase K (20 mg/mL) at 56°C followed by phenol‐chloroform‐DNA‐extraction. For up‐concentration, DNA was alcohol‐precipitated and redissolved and diluted in 1× TE‐buffer. The published PLD4‐variant was polymerase chain reaction (PCR)‐amplified with 2 separated primer‐systems resulting in a 244 and 426 bp fragment, respectively (1‐for: CCTCCTTCTCCCACCTGTAA/1‐rev: TTACAGACCTGCCTCCATCC and 2‐for: CTTGTCAGGTGCCCAGGT/2‐rev: TTACAGACCTGCCTCCATCC). Polymerase chain reaction products were enzymatically purified and sequencing reactions were done for both strands with BigDye Terminator v1.1 Cycle Sequencing Kit. Electrophoresis of purified sequencing reactions was performed on the ABI 3130xl Genetic Analyzer. The Phred/Phrap/Polyphred software suite, , was used for base calling, sequence alignment, and polymorphism detection. Sequences were viewed with Consed. To avoid false results because of DNA desamination, amplification reactions were performed repeatedly. […]

Pipeline specifications

Software tools Phrap, PolyPhred, Consed
Application Sanger sequencing
Organisms Bos taurus
Diseases Anemia, Communicable Diseases, Dermatitis, Skin Diseases, Genetic Diseases, Inborn, Hypoalbuminemia, Mucositis
Chemicals Zinc