Computational protocol: Specific Expression of Channelrhodopsin-2 in Single Neurons of Caenorhabditis elegans

Similar protocols

Protocol publication

[…] The following plasmids were kindly provided by N. Pokala (Bargmann lab, Rockefeller University, USA): pNP165: Pglr-1::flox::ChR2::mCherry, pNP259: Pgpa-14::Cre, pNP260: Pnmr-1::flox::ChR2::mCherry. Plasmids pWD172 (Entry-Vector for Slot-2 in Gateway cloning containing FLP) and pWD178 (Entry-Vector for Slot-2 in Gateway cloning containing FRT::mCherry::STOP::FRT) were kindly provided by E. Jorgensen . The plasmid pTNZ126 (containing FLP::unc-54-UTR) was a kind gift from W. Schafer. In addition, these plasmids were kindly provided: TU#712 (nzYFP = YFP(aa1-157)::zipper); TU#715 (czCFP = zipper::CFP(aa155-239)) (gifts by M. Chalfie ); spGFP1-10 (GFP(aa1-214)); spGFP11 (pat-3-signalpeptide::GFP(aa215-230)) (gifts by C. Bargmann ). Plasmids pAG54 (pmyo-3::ChR2::YFP) and pmyo-3::NpHR::eCFP were described previously , .The following plasmids were prepared in this work: pCoS2 (pnhr-79::Cre): As backbone, plasmid pNP259, cut with SphI and XmaI, was used. The inserted nhr-79 promoter was amplified from genomic DNA using oligos CAAGCTTGCATGCGCGGATAGACT TCCAGTTGTGAAT and CCATGGTACCGTCGATTTTATGCTAAAAATCGATAAATCAAGG. The insert was cloned using the In-Fusion Cloning Kit (CloneTech, USA). pCoS3 (psra-6::loxP::LacZ::STOP::loxP::ChR2::mCherry): As backbone, plasmid pNP165, cut with FseI and AscI, was used. The sra-6 promoter was amplified from psra-6::ChR2::YFP using oligos GCGGCCAAACATGATCTTAC and CATACCTTTGGGTCCTTTGG. pCoS6 (pglr-1::loxP::LacZ::STOP::loxP::ChR2::mCherry::SL2::GFP): To insert coding sequence for bicistronically expressed GFP into plasmid pNP165, an AvrII restriction site was added after ChR2::mCherry by site-directed mutagenesis; then the plasmid was opened using AvrII. The insert for bicistronically expressed GFP was amplified from plasmid pEntry(policys)GFP (a gift from M. de Bono, MRC Laboratory of Molecular Biology, Cambridge, UK) using oligos GGACCCAAAGGTATGTTTCG and TTAGGTACTAGTCGCTCAGTTGGAATTCTACG. pCoS10 (pflp-18::loxP::LacZ::STOP::loxP::ChR2::mCherry::SL2::GFP): pCoS6 was cut with SphI and BamHI, then the flp-18 promoter was inserted after amplification from plasmid pCS40 using oligos AAGCTTGGCCGGCCTCTGTCACATACTGCTCGAATC and AAGCTT GGCGCGCCGTCTAACCCTGAAATTATTATTTTTAGTTG. pCoS11 (prig-3::Cre): Plasmid pNP259 was cut with SphI and XmaI, and the rig-3 promoter was inserted after amplification from plasmid pCS42 using the oligos AAGCTTGGCCGGCCTTCTCTGCCTCCCTCAACTTC and AAGCTTGGCGCGCCTTTCGAAAAAGAAGAATGAAGTTCTTC. pCoS13 (posm-10::loxP::LacZ::STOP::loxP:: ChR2::mCherry::SL2::GFP): Plasmid pCoS6 was cut with SphI and BamHI, and the posm-10 promoter inserted after amplification from plasmid pKS52 (posm-10::GFP; a gift by Anne Hart, Brown University, USA) using oligos GAATTGCATGCTGCGCCTTTGAAGAGTACTG and AATTGTCGACCGAAAGTTGGCT CAACATCTC. pCS40 (pflp-18::FRT::mCherry::STOP::FRT::ChR2::YFP): Plasmids pCS45, pCS49, and pCS48 were conjointly used in a Gateway recombination reaction with the vector pDESTR4-R3 (Invitrogen) to generate pCS40. pCS41 (prig-3::FRT::mCherry::STOP::FRT:: ChR2::YFP): Likewise, plasmids pCS46, pCS49, and pCS48 gave rise to pCS41 in a Gateway recombination reaction with vector pDESTR4-R3 (Invitrogen). pCS45 (pflp-18 entry-Vector for Slot-1 in Gateway cloning): A ∼4,2 kbp fragment of the promoter pflp-18 was amplified from genomic C. elegans DNA by PCR using oligos oCS95 (GGGGACA ACTTTGTATAGAAAAGTTGGCTCTGTCACATACTGCTCG) and oCS96 (GGGGACTGC TTTTTTGTACAAACTTGGCATGTCTAACCCTGAAA). The purified PCR product was then used in a recombination reaction with pDONR-P4-P1r and BP Clonase II (Invitrogen) to generate pCS45. pCS46 (prig-3 Entry-Vector for Slot-1 in Gateway cloning): A ∼3,1 kbp fragment of the promoter prig-3 was amplified from genomic DNA by PCR using the oligos oCS93 (GGGGACAACTTTGTATAGAAAAGTTGGCTTCTCTGCCTCCCTCAACTTC) and oCS94 (GGGGACTGCTTTTTTGTACAAACTTGGCATTTTCGAAAAAGAAGAATGAAG). The purified PCR product was recombined with pDONR-P4-P1r using BP Clonase II (Invitrogen). pCS47: (unc-54 3′-UTR, Entry-Vector for Slot-3 in Gateway cloning): ∼0,8 kbps of the unc-54-UTR were PCR amplified from pAG54 , using oligos oCS99 (GGGGACAGCTTTCTTGT ACAAAGTGGGCTAACATCTCGCGCCCGTGCCTC) and oCS101 (GGGGACAACTTTG TATAATAAAGTTGGCGGCCGACTAGTAGGAAACAG). The purified PCR product was then used in a recombination reaction with pDONRP2R-P3 and BP Clonase II (Invitrogen) to generate pCS47. pCS48 (ChR2::YFP::unc-54-UTR, Entry-Vector for Slot-3 in Gateway cloning): A ∼2,6 kbp fragment containing ChR2::YFP::unc-54UTR was PCR amplified from pAG54 using oligos oCS100 (GGGGACAGCTTTCTTGTACAAAGTGGGCGCATG GATTATGGAGGCGCCC) and oCS101 (GGGGACAACTTTGTATAATAAAGTTGGCGGC CGACTAGTAGGAAACAG). The purified PCR product was then recombined with pDONRP2R-P3. pCS49 (FRT::mCherry::STOP::FRT, Entry-Vector for Slot-2 in Gateway cloning): A ∼1,5 kbp fragment containing FRT::mCherry::STOP::FRT was PCR amplified from pWD178 using oligos oCS97 (GGGGACAAGTTTGTACAAAAAAGCAGGC) and oCS98 (GGGGACCACTTTGTACAAGAAAGCTGGGTCGAAGTTCCTATACTTTCTAG). The purified PCR product was then recombined with pDONR221. pCS101 (pflp-18::FLP): A ∼4,2 kbp fragment of pflp-18 was amplified from pCS45 using oligos oCS200 (GTGGATCCGCTATCAACTTTGTATAGAAAAGTTG) and oCS205 (CACAGCTAGCGT CTAACCCTGAAATTATTATTT) and cloned into pTNZ126 using BamHI and BmtI cuts. pCS102 (prig-3::FLP): A ∼3,1 kbp fragment of prig-3 was amplified from pCS46 by PCR using the oligos oCS200 (GTGGATCCGCTATCAACTTTGTATAGAAAAGTTG) and oCS203 (CACAGCTAGCTTTCGAAAAAGAAGAATGAAG). The purified PCR product was then ligated into pTNZ126 after BamHI and BmtI restricition. pCS132 (prig-3::FRT::mCherry::STOP::FRT::ChR2::YFP): ∼1,5 kbp containing FRT::mCherry::STOP::FRT were amplified from pCS49 using oligos oCS229 (GTGTGCTAGCACCGGTGGGCCCGAAG TTCCTATTCTCTAGAAAG) and oCS230 (CACAGGGGCCCGAAGTTCCTATACTTTCTAG), and subsequently digested with a) AgeI and EcoRV (resulting in a 0,8 kbp fragment) and b) EcoRV and EcoO109I (resulting in 0,6 kbp fragment). In addition, a ∼2,5 kbp fragment containing ChR2::YFP::unc-54-3′-UTR was amplified from pAG54 by PCR using oligos oCS231 (GTGTGGGCCCCATGGATTATGGAGGCGCCCTG) and oCS232 (GGGCCCGTAC GGCCGAC) and digested with EcoO109I and BsiWI. All three fragments were then cloned into pCS102 using the restriction enzymes AgeI and BsiWI. pCS133 (pgpa-14b::FLP): A ∼3,0 kbp fragment of pgpa-14b was amplified from genomic DNA using oligos oCS236 (GTGTCCTGCAGGACGACGACAAGAAGGTAATT) and oCS237 (CACAGCTAGCTACA CCTGAATTTTATAAG), and subcloned into pTNZ126 following SbfI and BmtI digestion. pCS134 (pglr-1::FLP): A ∼5,3 kbp fragment ofthe promoter pglr-1 was amplified from pCS106 by PCR using the oligos oCS233 (CATGCCTGCAGGGGCCGGCCGTAGCCGGTATG) and oCS234 (CACAGCTAGCC TGTGAATGTGTCAGATTGG). The purified PCR product was then cloned into pTNZ126 using SbfI and BmtI. pCS135 (pgpa-14b::FRT::mCherry::STOP::FRT::ChR2::YFP): ∼3,0 kbps of pgpa-14b were amplified from pCS133 using oligos oCS236 (GTGTCCTGCAGGACGACGACAAGAAGGTAATT) and oCS238 (CACAACC GGTTACACCTGAATTTTATAAG), and cloned into pCS132 after SbfI and AgeI digest. pCS136 (pglr-1::FRT::mCherry::STOP:: FRT::ChR2::YFP): A ∼5,3 kbp fragment of the promoter pglr-1 was amplified from pCS134 using oligos oCS233 (CATGCCTGCAGGGGCC GGCCGTAGCCGGTATG) and oCS235 (CACAACCGGTCTGTGAATGTGTCAGATTGG). The purified PCR product was then cloned into pCS132 using restriction enzymes SbfI and BmtI. pSH116 (pdes-2::Cre): Plasmid pNP259 was cut with SphI and NcoI and the des-2 promoter inserted after amplification from genomic DNA using oligos ACGTAGCATGCGATC TCAAAGTACATACATTC and ATCCATGGCCTGTAGTAAAAGTAAATGTG.The first 29 amino acids of the ChR2 primary structure were recognized as eukaryotic signal sequence by computational analysis (SignalP ) and were referred to as ChR2-signal sequence. Similarly, using an alternative upstream start codon within the genome of Natronomonas pharaonis added additional 19 amino acids to the amino-terminus which were recognized as eukaryotic signal peptide, again using SignalP. This sequence was cloned into plasmid pCS10: pmyo-3::NpHR-SigSeq::NpHR::eCFP , and termed NpHR-signal sequence. Sites of fragmentation within ChR2(H134R) and NpHR were selected in loop-regions in order to minimize impact on functionality of the respective rhodopsin. To this end, the primary structures of ChR2(H134R) and NpHR were aligned with the homologous bacteriorhodopsin and Halorhodopsin structures from Halobacterium salinarium – using the tools ClustalW , HMMTOP , MEMSAT3 , and T-Coffee . Furthermore, structural information about ChR2(H134R) was contributed by P. Wood and E. Bamberg and for NpHR by L. Forrest (all Max-Planck Institute for Biophysics). The topology of individual fragments was analyzed using the algorithms of TMHMM and SOSUI . The following plasmids were generated using standard techniques: pCS1: pmyo-3::nzYFP::ChR2 (Helices3-7; Ala111-Thr314), pCS1+: pmyo-3::ChR2-SigSeq::nzYFP::ChR2 (Helices3-7; Ala111-Thr314), pCS2: pmyo-3::ChR2 (Helices1-2; Met1-Leu110)::czCFP, pCS3: pmyo-3::nzYFP::ChR2 (Helices4-7; Asn143-Thr314), pCS4: pmyo-3::ChR2 (Helices1-3; Met1-Ser142)::czCFP, pCS5: pmyo-3::NpHR-SigSeq::NpHR::eCFP, pCS6: pmyo-3::ChR2 (Helices1-5; Met1-Gly206)::czCFP, pCS14: pmyo-3::NpHR (Helices1-3; Met1-Ser144), pCS14+: pmyo-3::NpHR-SigSeq::NpHR (Helices1-3; Met1-Ser144), pCS16: pmyo-3::NpHR (Helices 4-7; Ser144-Asp291)::eCFP, pCS20: pmyo-3::ChR2 (Helix 1, Met1-Thr74), pCS21: pmyo-3::ChR2 (Helices 1-2, Met1-Pro105), pCS22: pmyo-3::ChR2 (Helices 1-5, Met1-Gly199), pCS23: pmyo-3::ChR2 (Helices 2-7, Lys76-Thr314), pCS24: pmyo-3::ChR2 (Helices 3-7, Ser106-Thr314), pCS24+: pmyo-3::ChR2-SigSeq::ChR2 (Helices 3-7, Ser106-Thr314), pCS25: pmyo-3::ChR2 (Helices 6-7, Tyr200-Thr314), pCS26: pmyo-3::ChR2 (Helix 1, Met1-Thr74)::YFP::ChR2 (Helices 2-7, Trp75-Thr314), pCS27: pmyo-3::ChR2 (Helices 1-2, Met1-Pro105)::YFP::ChR2 (Helices 3-7, Ser106-Thr314), pCS28: pmyo-3::ChR2 (Helices 1-5, Met1-Gly199)::YFP::ChR2 (Helices 6-7, Tyr200-Thr314, pCS80: pmyo-3::NpHR (Hel. 1-2; Met1-Gly88), pCS81: pmyo-3::NpHR-SigSeq::NpHR (Hel. 1-2; Met1-Gly88), pCS82: pmyo-3::NpHR (Hel. 3-7; Leu89-Asp291)::eCFP, pCS83: pmyo-3::NpHR (Hel. 1; Met1-Pro62), pCS85: pmyo-3::NpHR (Hel. 2-7; Arg63-Asp291)::eCFP, pCS89+: pmyo-3::pat-3 SigSeq::spGFP11:: NpHR (Hel. 3-7; His100-Asp291), pCS90+: pmyo-3::NpHR (Hel. 1-2; Met1-Gly99)::spGFP1-10, pCS91+: pmyo-3::NpHR SigSeq::NpHR (Hel. 1-2; Met1-Gly99):: spGFP1-10, pCS92: pmyo-3::NpHR (Hel. 1-2; Met1-Gly99), pCS94: pmyo-3::NpHR (Hel. 3-7; His100-Asp291)::eCFP […]

Pipeline specifications

Software tools SignalP, Clustal W, HMMTOP, MEMSAT, T-Coffee, TMHMM, SOSUI
Applications Protein sequence analysis, Membrane protein analysis
Organisms Caenorhabditis elegans