Computational protocol: Insights into Alpha-Hemolysin (Hla) Evolution and Expression among Staphylococcus aureus Clones with Hospital and Community Origin

Similar protocols

Protocol publication

[…] Chromosomal DNA was extracted from overnight cultures, using the boiling method (100°C for 10 min followed by centrifuged at 13.000 g for 5 minutes). Two sets of primers were designed to span the most polymorphic regions within the hla gene and hla promoter (considered as the region located −600 bp from hla starting codon), after alignment of sequences available on NCBI for S. aureus. One set of primers (Forward: hla-F_CGAAAGGTACCATTGCTGGT; Reverse: hla-R_CCAATCGATTTTATATCTTTC) amplified an internal fragment of the hla gene (nt 1170419–1170982, CP000730.1) and the other set (Forward: hlaPro-F_CACTATATTAAAAATACATAC; Reverse: hlaPro-R_GTTGTTACTGAGCTGAC) amplified an internal fragment of the hla promoter region (nt 1171289–1171773, CP000730.1) (). PCR products were sequenced (Macrogen Europe, Amsterdam, The Netherlands) and sequences were analyzed using SeqMan (DNAstar, Lasergene v9, Madison, WI, USA). To each unique hla promoter (P) and gene sequence (hla) - allotype - a single Arabic number was attributed (e.g. P1, P2; hla1, hla2). Gene and promoter sequences were deposited in GenBank (accession numbers KM019547–KM019606; KM019607–KM019674). [...] Phylogenetic relatedness was analyzed using the MEGA5 v5.05 software (http://www.megasoftware.net/) for gene, promoter region and concatenated sequences obtained from 1) gene with promoter region and 2) seven MLST alleles from the 23 representative STs within the collection. Phylogenetic trees were constructed using the Neighbor-Joining clustering method, and 1000 bootstrap replicates, which assigns confidence values for the groupings in the tree.Moreover, nucleotide diversity (ND) between the two clusters was calculated based on the estimation of the average evolutionary divergence over sequence pairs within the two groups, where the number of base substitutions per site from averaging over all sequence pairs within each group are compared using the maximum composite likelihood model . […]

Pipeline specifications

Software tools DNASTAR Lasergene, MEGA
Applications Phylogenetics, Sanger sequencing
Organisms Staphylococcus aureus, Epipremnum aureum
Diseases Staphylococcal Infections
Chemicals Methicillin