Computational protocol: Bats, Trypanosomes, and Triatomines in Ecuador: New Insights into the Diversity, Transmission, and Origins of Trypanosoma cruzi and Chagas Disease

Similar protocols

Protocol publication

[…] We sequenced fragments of the 18S rRNA and cytb genes of Trypanosoma from a subset of eight positive animals from three localities that yielded positive results (). Not all the positive samples were sequenced because animals were collected in groups and most likely share the same parasite genotypes. To amplify the 18S rRNA, we followed a nested PCR protocol [] with the following modifications: the initial PCR amplification was conducted with the newly designed primers SSU4_F (GTGCCAGCACCCGCGGTAAT) and 18Sq1R (CCACCGACCAAAAGCGGCCA); both nested PCR amplifications were run with a touchdown PCR profile []. The cytb gene was amplified following a published protocol []. After cleaning the PCR products with ExoSAP-IT (Affymetrix, Santa Clara, CA), we did sequencing reactions in both directions with the ABI BigDye chemistry (Applied Biosystems, Inc., Foster City, CA), and sequenced the fragments on an ABI 3730xl DNA Analyzer automatic sequencer (Applied Biosystems, Inc., Foster City, CA).We built a matrix for each gene with sequences of previous studies of lineage diversity of T. cruzi e.g., [,,,] and also used sequences of Trypanosoma dionisii and Trypanosoma erneyi as outgroups [] (). We assembled each gene fragment with the Geneious Alignment tool in Geneious v. 6.1.8 [], and the alignments were checked and corrected manually. The 18S rRNA and cytb alignments were cropped at 863 bp (99 sequences) () and 490 bp (362 sequences) () respectively. We built a network genealogy for the 18S rRNA gene with the program SplitsTree v. 4.11.3 using the NeighborNet method []. Internode supports were estimated by performing 100 bootstrap replicates using the same parameters optimized for network inferences. For the alignment of the cytb gene we started a maximum likelihood run in RAxML v. 8 [] and interrupted it after obtaining the reduced matrix that contains only one sequence per unique haplotype (). Following this, we ran to completion the analysis with the GTR-CAT approximation on the reduced matrix. The GTR-CAT approximation is a rapid algorithm for ML analyses that resembles the GTR-G model, but it is optimized for faster performance [].Also, to test the combinability of the 18S rRNA and cytb genes for concatenated phylogenetic analysis we used the software MLSTest [] to run the analysis ILD-BIONJ [] that is an efficient variant of the incongruence length difference test []. We ran ILD-BIONJ with reduced alignments that only contained strains represented for both genes. This analysis determined that our loci had significantly different branching patterns (p = 0.0099), so no further concatenated analyses were performed. [...] We calculated the nucleotide diversity (π) of each T. cruzi subdivision on the cytb tree (i.e., TcI, TcII, TcIII-TcVI, Tcbat, and the subspecies T. c. marinkellei). In Mega v. 6 [] we used the option “compute mean diversity in entire population”, which calculates a nucleotide diversity index that is independent of sample size (equation 12.73 in []). Standard errors were estimated by 1,000 bootstrap replicates. The 18S rRNA fragment was not used for these calculations because of indels within the alignment, which are removed from the calculations producing severe underestimations of nucleotide diversity. […]

Pipeline specifications

Software tools Geneious, SplitsTree, NeighborNet, RAxML, MLSTest, MEGA-V
Applications Phylogenetics, WGS analysis, GWAS
Organisms Trypanosoma cruzi, Trypanosoma brucei, Toxoplasma gondii
Chemicals Nucleotides