ACLAME statistics

Tool stats & trends

Looking to identify usage trends or leading experts?

Protocols

ACLAME specifications

Information


Unique identifier OMICS_01528
Name ACLAME
Alternative name A CLAssification of Mobile genetic Elements
Restrictions to use None
Database management system PostgreSQL
Data access File download, Browse
Version 0.4
Maintained Yes

Maintainer


  • person_outline Raphaël Leplae

Publications for A CLAssification of Mobile genetic Elements

ACLAME citations

 (72)
library_books

Metagenomics Reveals the Impact of Wastewater Treatment Plants on the Dispersal of Microorganisms and Genes in Aquatic Sediments

2018
Appl Environ Microbiol
PMCID: 5812944
PMID: 29269503
DOI: 10.1128/AEM.02168-17

[…] ified into that category.To evaluate which ARGs were located on MGEs (“mobile ARGs”), the protein sequences from each metagenome were subjected to a blastp search against the plasmid protein database ACLAME (http://aclame.ulb.ac.be) using the same cutoff threshold described above. The blast result files from the ACLAME plasmid database, which includes ARG-encoding plasmids, were then matched to th […]

call_split

Metavirome Sequencing of the Termite Gut Reveals the Presence of an Unexplored Bacteriophage Community

2018
Front Microbiol
PMCID: 5759034
PMID: 29354098
DOI: 10.3389/fmicb.2017.02548
call_split See protocol

[…] ene.com). PHACTS analysis was carried out to determine the lifestyle and host of the putative phages (McNair et al., ). Family assignment of putative phage genomes was performed with VIRFAM using the ACLAME database (Lopes et al., ). For contig LSPY100002, RNA polymerase beta and beta' subunit sequences from phiKZ-like bacteriophages were used to construct phylogenetic trees (Lavysh et al., ). Fun […]

library_books

First draft genome sequence of a strain belonging to the Zoogloea genus and its gene expression in situ

2017
Stand Genomic Sci
PMCID: 5648520
PMID: 29075368
DOI: 10.1186/s40793-017-0274-y

[…] CGCTCCGGAGGGAGCGACTTCGTTGAAG). These CRISPRs contain 175, 51 and 11 spacers, respectively, ranging from lengths of 33 to 46 bp. A total of 77 matches were found when searching the spacers against the ACLAME phage/viral/plasmid gene database, NCBI phage and NCBI virus databases using the CRISPRtarget tool []. 51 of the spacers match to bacteriophages, 6 to viruses, 11 to genes within plasmids and s […]

library_books

Rapid Gene Turnover as a Significant Source of Genetic Variation in a Recently Seeded Population of a Healthcare Associated Pathogen

2017
Front Microbiol
PMCID: 5611417
PMID: 28979253
DOI: 10.3389/fmicb.2017.01817

[…] milies, homologous groups that have only one gene per genome. We also assigned, when possible, the CRHGs to their potential MGEs, for doing that we used two databases: ISfinder (Siguier et al., ) and ACLAME (Leplae et al., ). We conducted BLAST searches for each gene of each CRHG against those two databases with an e-value of 1.0 e−30 and requiring that the query sequence aligned ≥60% of its lengt […]

library_books

Evolution of Sphingomonad Gene Clusters Related to Pesticide Catabolism Revealed by Genome Sequence and Mobilomics of Sphingobium herbicidovorans MH

2017
Genome Biol Evol
PMCID: 5737581
PMID: 28961970
DOI: 10.1093/gbe/evx185

[…] s.The previously identified minimal core 206 gene set for bacteria () was used to separate chromosomal replicons from plasmid ones. These are referred to as housekeeping genes. A manual subset of the ACLAME () plasmid database (4,721 genes; ) was used to identify genes involved in plasmid transfer, replication, and partitioning using BLASTP. […]

library_books

Review article: the human intestinal virome in health and disease

2017
PMCID: 5656937
PMID: 28869283
DOI: 10.1111/apt.14280

[…] ropagation. Findings regarding prophages were not in accord with previous studies (they did far more in‐depth analyses than previous studies): 2814 contigs had significant amino acid homology with an ACLAME prophage sequence, 41% were assigned to Firmicutes, 0.9% were assigned to Bacteroidetes, 16% were assigned to the Proteobacteria. This pattern did not match abundance of bacteria within samples […]

Citations

Looking to check out a full list of citations?

ACLAME institution(s)
Bioinformatique des Génomes et des Réseaux, Université Libre de Bruxelles, Boulevard du Triomphe, Bruxelles, Belgium
ACLAME funding source(s)
Supported by European Space Agency (ESA-PRODEX) and the Belgian Science Policy (Belspo) through the MISSEX project (PRODEX agreements No. C90254), the Fonds de la Recherche Scientifique Medicale (FRSM) and the Belgian Program on Interuniversity Attraction Poles, initiated by the Belgian Federal Science Policy Office, project P6/25 (BioMaGNet), the BioSapiens Network of excellence funded under the sixth Framework program of the European Communities (LSHG-CT-2003-503265).

ACLAME reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review ACLAME