Computational protocol: Molecular identification and transmission studies of X cell parasites from Atlantic cod Gadus morhua (Gadiformes: Gadidae) and the northern black flounder Pseudopleuronectes obscurus (Pleuronectiformes: Pleuronectidae)

Similar protocols

Protocol publication

[…] Ethanol fixed pseudotumour material and negative control tissues were homogenised with a sterile Eppendorf pestle and digested overnight at 56°C in 0.4 ml high concentration urea buffer containing 100 μg/ml proteinase K. DNA was extracted using a QIAamp DNA Mini Kit (QIAGEN Inc.) following the manufacturer's tissue protocol and used as template DNA for subsequent PCR reactions.Partial SSU rDNA for both X-cell parasites was first amplified using the primer pair: H-F1 M 5' gttctttcttgattctatrag 3' and H-R3 M 5' taggaattcctcgttcaagacg 3' that were modified from degenerate haplosporidian primers [], and require a 48°C annealing temperature. Universal primers 18e [] and 606f/r and 18gM [] were used in combination with the above primers and with more specific X-cell primers designed from initial sequence reads (Table ). All PCRs were performed in 20 μl volumes containing ~10 ng of genomic DNA, 15 pmol of each primer, 0.25 mM of dNTP, PCR buffer with a final MgCl2 concentration of 2 mM and 0.5 units of Taq DNA polymerase. After an initial denaturation at 95°C for 5 min, samples were subjected to 35 cycles of amplification (denaturation at 95°C for 30 s, primer annealing at 55°C for 30 s (unless otherwise stated), and extension at 72°C for 1 min), followed by a 7 min terminal extension at 72°C. PCR amplicons were purified using a PCR purification kit (QIAGEN Inc) and used directly in sequencing reactions. The sequencing reactions were performed using BigDye® Terminator Cycle Sequencing chemistry utilising the same oligonucleotide primers that were used for the PCRs. DNA sequencing was completed on amplicons from four infected fish for each species. Sense and anti-sense strands were sequenced for all PCR products and contiguous sequences constructed manually using CLUSTAL_X [] and BioEdit []. CLUSTAL_X was used for the sequence alignments with the settings for gap opening/extension penalties being adjusted manually to achieve optimum alignments. Regions of ambiguous sequence alignments were manually edited using the BioEdit sequence alignment editor and final alignments of specific taxa were generated using CLUSTAL_X.Appropriate taxa were chosen for the phylogenetic analyses by performing nucleotide BLAST searches with the X-cell sequences [] and reviewing previous phylogenetic analyses that included X-cell sequence data [,,]. Additional taxa were chosen to further represent the major protist phyla (see Additional file ).Phylogenetic analyses were conducted using maximum parsimony (MP) methodologies in PAUP*4.0 beta10 []. MP analysis was done using a heuristic search with tree bisection-reconnection (TBR) branch swapping, 10 random taxon addition replicates, using the accelerated transformation (ACCTRAN) option. Gaps were treated as missing data and clade support was assessed using bootstrapping with 1000 replicates. Bayesian inference (BI) analyses were conducted using MrBayes v. 3.0 []. Models of nucleotide substitution were evaluated for the data using MrModeltest v. 2.2 []. The most parameter-rich evolutionary model based on the AIC was the general time-reversible, GTR+I+G model of evolution. Therefore, the settings used for the analysis were nst = 6, with the gamma-distributed rate variation across sites and a proportion of invariable sites (rates = invgamma). The priors on state frequency were left at the default setting (Prset statefreqpr = dirichlet (1,1,1,1)). Posterior probability distributions were generated using the Markov Chain Monte Carlo (MCMC) method with four chains being run simultaneously for 1,000,000 generations. Burn in was set at 2500 and trees were sampled every 100 generations making a total of 7500 trees used to compile the consensus trees. […]

Pipeline specifications

Software tools Clustal W, BioEdit, PAUP*, MrBayes, MrModelTest
Application 16S rRNA-seq analysis
Organisms Gadus morhua, Trachypithecus obscurus, Ruspolia dubia
Diseases Epidermal Cyst