Computational protocol: An outbreak of the 2009 influenza a (H1N1) virus in a children’s hospital

Similar protocols

Protocol publication

[…] To sequence hemagglutinin (HA) and PB2 genes, viral RNA (vRNA) was isolated from nasopharyngeal swabs from all four subjects, using the MinElute virus spin kit (Qiagen, Germantown, MD, USA). Sequence gaps in the samples from the second timepoint from Patient no. 2 were filled using a third‐passage virus stock grown from the original nasal wash. Sequence of this expanded virus matched available contemporaneous ex vivo virus sequences (data not shown). vRNA from the in vitro‐expanded stock was amplified using Qiagen’s One‐Step RT‐PCR kit with PB2 and HA gene‐specific primer sets developed by the WHO Collaborating Center for Influenza at the Centers for Disease Control and Prevention (CDC; primer sequences and protocol published at: http://www.who.int/csr/resources/publications/swineflu/sequencing_primers/en/index.html). vRNA from patient samples was amplified using a nested approach: first, cDNA was generated using Invitrogen’s SuperScript™ (Carlsbad, CA, USA) III First‐Strand Synthesis kit with primer 5′ NCR 3′ (5′‐AGCGAAAGCAGG‐3′). Each RT reaction was followed by two 45‐cycle PCR. The first PCR was performed using BioRad’s (Hercules, CA, USA) iProof High‐Fidelity DNA Polymerase, primers MBtuni‐13 and MBtuni‐12a (MBtuni‐13 – 5′‐ACGCGTGATCAGTAGAAACAAGG‐3′ and MBtuni‐12a – 5′‐ACGCGTGATCAGCGAAAGCAGG‐3′; originally described by Zhou et al., and the following cycling conditions: 98°C for 30 seconds, 45 cycles of 98°C for 15 seconds, 62°C for 30 seconds, 72°C for 2 minute, and a final extension time of 10 minute at 72°C. The second PCR was performed using Qiagen’s HotStarTaq polymerase and the WHO PB2 and HA gene‐specific primer sets. The cycling conditions for the second PCR were as follows: 95°C for 15 minute, 45 cycles of 94°C for 30 seconds, 56°C for 30 seconds, 72°C for 40 seconds, and a final extension time of 10 minute at 72°C. Both strands of each amplicon were sequenced on a 3730 DNA Analyzer (Applied Biosystems, Foster City, CA, USA). Sequences were assembled using CodonCode Aligner version 3·5·6 (CodonCode Corporation, Dedham, MA, USA) and analyzed in MacVector 11·1·1 trial version (Accelrys, San Diego, CA, USA). Phylogenetic analyses were performed using mega5 software (Tamura et al., 2011, Mol Biol Evol). Trees were constructed using the neighbor‐joining method (Saitou and Nei, 1987, Mol Biol Evol, 4, 406–425) with a Tamura/Nei maximum composite likelihood distance correction. Accession numbers for these sequences are pending. […]

Pipeline specifications

Software tools CodonCode Aligner, MacVector
Application Phylogenetics
Organisms Influenza A virus, Homo sapiens
Diseases Infection, Influenza, Human, HIV Infections