AmiRNA Designer specifications

Information


Unique identifier OMICS_11916
Name AmiRNA Designer
Software type Package/Module
Interface Graphical user interface
Restrictions to use None
Input data A target gene sequence
Input format Fasta or plain text
Operating system Unix/Linux
Programming languages Perl
Computer skills Medium
Stability Stable
Maintained Yes

Download


Versioning


Add your version

Documentation


Maintainer


  • person_outline Jacek Blazewicz <>

Publication for AmiRNA Designer

AmiRNA Designer in publications

 (5)
PMCID: 5856398
PMID: 29547640
DOI: 10.1371/journal.pone.0194150

[…] online tool to design amirnas; presently wmd3 version is available.), to get amirna sequences against haace1. initially, a number of potential micrornas targeting haace1 were obtained using the amirna designer platform. a few amirnas starting with uridine residue and targeting different regions of haace1 were manually selected and screened for absence of any off-targets against human, […]

PMCID: 4464980
PMID: 25809382
DOI: 10.1111/tpj.12835

[…] from the chimeric osmir390‐atl and from authentic osmir390 precursors (figure a). the sequences for amir‐bdbri1, amir‐bdcad1, amir‐bdcao and amir‐bdspl11 (figure s5) were designed using the ‘p‐sams amirna designer’ tool (http://p-sams.carringtonlab.org). plants expressing 35s:gus were used as negative controls. phenotypes of transgenic plants, amirna accumulation, processing of amirna […]

PMCID: 4295845
PMID: 25590629
DOI: 10.1371/journal.pone.0115418

[…] using xhoi/hindiii and cloned into pgreen 35s vector digested with the same restriction enzymes. to construct amir::at5g17960, amirna sequence (5’-gcgggaagcaagtatccactt-3’) was designed using the amirna designer interface wmd [, ]. the sequence was introduced into arabidopsis mir319a precursor by overlapping pcr using primers (a15_i_mir, a15_ii_mir, a15_iii_mir, a15_iv_mir) and prs300 plasmid […]

PMCID: 4007649
PMID: 24618103
DOI: 10.1186/1471-2229-14-62

[…] stuppo2 (previously, pot32), stuppo3 (previously, pot33) and stuppo4 (previously, pot72), individually or cumulatively were designed in an arabidopsis mir-168a gene backbone using an in-house amirna designer and constructed as previously described []. all constructs were sequenced to confirm the intended construction and the designs. descriptions of the amirnas, their target sequences […]

PMCID: 3589423
PMID: 23472140
DOI: 10.1371/journal.pone.0058103

[…] was obtained by overlapping pcr using gfp and iaa15 cdna as templates and cloned into the kpni and bamhi sites of pcambia1301s. for amirna-iaa15, amirnas were designed to knock down iaa15 using the amirna designer interface wmd2 (http://wmd2.weigelworld.org). the amirna targeting the “catagcaatcgtacatcccaa” sequence located in the second exon of iaa15 was chosen and constructed by overlapping […]


To access a full list of publications, you will need to upgrade to our premium service.

AmiRNA Designer institution(s)
Institute of Bioorganic Chemistry, Polish Academy of Sciences, Poznan, Poland; Institute of Computing Science, Poznan University of Technology, Poznan, Poland
AmiRNA Designer funding source(s)
This work was supported by grant from National Science Center, Poland [2012/05/B/ST6/03026] and by DS grant from II PP [09/91/DSPB/0585].

AmiRNA Designer reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review AmiRNA Designer