Computational protocol: Living with marginal coral communities: Diversity and host-specificity in coral-associated barnacles in the northern coral distribution limit of the East China Sea

Similar protocols

Protocol publication

[…] Total genomic DNA was extracted from the soft tissue of barnacle specimens using the Qiagen QIAquick Tissue Kit (Chatsworth, CA, USA) following the manufacturer’s instructions. Partial sequences of the mitochondrial genes 12S rDNA (12S) and cytochrome c oxidase subunit I (COI) were amplified using polymerase chain reaction with the primers 12S-FB and 12S-R2 [] and COI-F5 5′ AAACCTATAGCCTTCAAAGCT 3′ and COI-R4 5′ GTATCHACRTCYATWCCTACHG 3′ [], respectively. Mitochondrial markers including COI and 12S are useful for species delineations in coral-associated barnacles and a number of studies have used these two markers for new species descriptions [–]. There are large numbers of mitochondrial gene sequences from coral-associated barnacles available from the Genbank. The use of mitochondrial markers in the present study makes it possible to compare species diversity data from Jeju waters with other available mitochondrial sequences. The PCR solution contained 40 ng of template DNA, 5 μL of Taq DNA Polymerase Master Mix (1.5 mM MgCl2; Ampliqon, Denmark), 1 μM of each primer, and ddH2O for a total volume of 10 μL. PCR was conducted under the following conditions: 2 min at 95°C for initial denaturation, 35 cycles of 30 s at 95°C, 1 min at 48°C, 1 min at 72°C, and a final extension for 5 min at 72°C. The PCR products were then purified using a DNA gel purification kit (Tri-I Biotech, Taipei, Taiwan). Direct sequencing of the purified PCR products was performed using the ABI 3730XL Genetic Analyzer with BigDye terminator cycle sequencing reagents (Applied Biosystems, Foster City, CA, USA).DNA sequences were proofread using MEGA v. 7 [] and aligned with the Cantellius sequences from GenBank through multiple alignment using MAFFT v. 6.717 []. Alignments were also examined visually and ambiguous positions were adjusted manually. A matrix of genetic distances within and among the species was generated using Kimura’s two-parameter model in MEGA v. 7. The stability of clades was evaluated using bootstrap tests with 1,000 replications. A maximum likelihood (ML) test was conducted for concatenated datasets (mitochondrial COI + 12S). ML analysis was performed using RAxML-HPC2 on XSEDE [] through the online server Cyberinfrastructure for Phylogenetic Research (CIPRES) with the GTRGAMMA model of nucleotide substitution and 1,000 bootstrap replicates. For analysis, other Cantellius and pyrgomatid species available from the Genbank were used for comparisons () and Amphibalanus amphitrite was selected as an outgroup. The use of A. amphitrite as an outgroup candidate is appropriate for molecular phylogenetic analysis of coral-associated barnacles because from a previous study on molecular phylogeny of coral-associated barnacles [], the coral-associated barnacle clade (pyrgomatid clade) is sister to balanid clade including A. amphitrite. […]

Pipeline specifications

Software tools MEGA-V, MAFFT, RAxML
Applications Phylogenetics, GWAS