Computational protocol: Molecular Dissection of Induced Platinum Resistance through Functional and Gene Expression Analysis in a Cell Culture Model of Bladder Cancer

Similar protocols

Protocol publication

[…] Total RNA was isolated using Qiagen RNeasy mini kit. Co-purified genomic DNA was quantified using an 18S gene-specific quantitative PCR assay with human genomic DNA as the quantity standard. Since total RNA had high levels of genomic DNA contamination (predicted to account for 15–68% of total reads), an additional DNase treatment step was added to the RNA purification protocol. This step reduced the DNA contamination to levels expected to produce <0.33% of total reads. rRNA was depleted from the samples using Epicentre's RiboZero H/M/R kit. Sequencing libraries were made from 40 ng of rRNA depleted RNA using Epicentre's ScriptSeq v2 RNA-Seq Library Preparation Kit. These samples were sequenced on 1/3 of a HiSeq PE 101 lane each at Los Alamos National Laboratory.Raw sequencing data were processed by CASAVA 1.8 software (Illumina; San Diego, CA) and trimmed for quality (Q30, Phred scale). Analysis of RNA-Seq data was performed using a standard TopHat-__STRONG_START__Cufflinks workflow with human genome assembly (Feb. 2009, GRCh37/hg19) [, ]. The expression of a transcript was considered significantly regulated if FDR (p-value corrected for multiple testing) was less than 0.05.For qRT-PCR, RNA was isolated from subconfluent dishes using the Qiagen RNeasy Mini Kit according to the manufacturer’s instructions. cDNA was synthesized using the Thermo Scientific RevertAid RT kit. qRT-PCR was performed using the EconoTaq PLUS 2X master mix on a BioRad CFX96 Real-Time System instrument. The following primers were used: TSPAN7 (ACCAAACCTGTGATAACCTGTCT, AGGGAGATATAGGTGCCCAGA), AKR1C2 (ATTGGAATGACATACTGCATCCT, GTTCAACCGTTTCTTACCTGTGG), AKR1C1 (CGCCTGCAGAGGTTCCTAAAA, ATCAATATGGCGGAAGCCAG), CYR61 (CCCGTTTTGGTAGATTCTGG, GCTGGAATGCAACTTCGG), HTRA1 (TCCCAACAGTTTGCGCCATAA, CCGGCACCTCTCGTTTAGAAA), and AQP3 (CCGTGACCTTTGCCATGTG, CGAAGTGCCAGATTGCATCATAA). Any RNA seq data not presented in the paper is available online at http://www.ncbi.nlm.nih.gov/sra. Raw RNA seq data have been assigned accession ID numbers SRR1820076 and SRR1820077 for the 5637 parental line; and SRR1820079 and SRR1820080 for the 5637R line (representing two independent experiments for each cell line). […]

Pipeline specifications

Software tools BaseSpace, TopHat, Cufflinks
Application RNA-seq analysis
Organisms Homo sapiens
Diseases Urinary Bladder Neoplasms, Drug-Related Side Effects and Adverse Reactions
Chemicals Cisplatin, Doxorubicin, Glutathione, Methotrexate, Platinum, Vinblastine, Carboplatin