Computational protocol: Versatile Antagonistic Activities of Soil-Borne Bacillus spp. and Pseudomonas spp. against Phytophthora infestans and Other Potato Pathogens

Similar protocols

Protocol publication

[…] Bacterial identification was performed through 16S rRNA gene sequencing. For this, bacterial isolates were grown overnight on LB-agar and one single colony was picked-up for “colony-PCR” using primers pair 27F (AGAGTTTGATCCTGGCTCAG) and 1492F (GGTTACCTTGTTACGACTT). PCR reactions were performed using the GoTaq® G2 Flexi DNA Polymerase (Promega) with colorless buffer following the manufacturer's recommendations. Thermal cycling parameters were as follows: a denaturation step at 95°C for 5 min followed by 30 cycles at 95°C for 1 min, 55°C for 30 s and 72°C for 90 s. Finally, an elongation step at 72°C for 10 min. PCR amplicons were verified by gel electrophoresis, purified using the GenElute PCR cleanup kit (Sigma) and sequenced in both orientations at Macrogen Europe (Amsterdam, The Netherlands). For each bacterial isolate, nucleotide sequences were trimmed, aligned and compared with the BLASTn search available in GenBank database. Sequences were deposited in the NCBI database under GenBank accession numbers MF062580 to MF062639. Phylogenetic relationships based on partial 16S rRNA gene sequences were determined with MEGA 6.0 software (Tamura et al., ) using maximum likelihood (ML) method with the General Time-Reversible plus gamma model of nucleotide substitution and bootstrap values of 1,000 iterations. […]

Pipeline specifications

Software tools BLASTN, MEGA
Applications Phylogenetics, 16S rRNA-seq analysis
Organisms Solanum tuberosum, Phytophthora infestans, Escherichia coli, Fusarium solani, Pectobacterium carotovorum, Rhizoctonia solani, Bacteria, Bacillus pumilus, Bacillus amyloliquefaciens, Bacillus subtilis, Pseudomonas protegens