Computational protocol: The tobacco carcinogen NNK drives accumulation of DNMT1 at the GR promoter thereby reducing GR expression in untransformed lung fibroblasts

Similar protocols

Protocol publication

[…] Cells (1000) from day 74 of the chronic experiment were harvested and cultured in cell culture dishes for 12 days to achieve 6 cell divisions. The cells were then fixed with cold methanol (Merck) and stained with 0.5% crystal violet (Merck). Images of the dishes were captured and the numbers of spots/colonies were determined using Icy - Spot Detector. [...] DNA was extracted from MRC-5 cells (DNeasy® Blood & Tissue Kit, QIAGEN, UK) and bisulfite-converted (EZ DNA Methylation™ Kit, Zymo Research). Bisulfite-specific PCR was performed in a Veriti 96 Well Thermal Cycler (Applied Biosystems) using ZymoTaq™ DNA polymerase (Zymo Research), as per the manufacturer’s instructions. Primer sequences are as follows: 1B F 5′TGACTGGAGTTCAGACGTGTGCTCT TCCGATCTGGGAGGGGTGGGGGTTGAATTTGGTAGG3′, R 5′ACACTCTTTCCCCACACGACGCTCTTCCGATCTC CCTCTAAAAAAACTTCAAAAAAAAAAC3′; 1C F 5′TGACTGGAGTTC AGACGTGTGCTCTTCCGATCTGGGGGTG GAGTGGGAG3′, R 5′ACACTCTTTCCCCACACGACGCTCTTCCGATCTCTTCT TACCTCTAACAAAAAAACC3′; 1F F 5′TGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGTTTTTTTTTTGAAGT TTTTTTAGAGGG3′, R 5′ACACTCTTTC CCCACACGACGCTCTTCCGATCTCC CCCAACTCCCCAAAAAAAAAAA TAAC3′; 1J F 5′TGACTGGAGTTCAGACG TGTGCTCTTCCGATCTGGATTGAGGGGGAAGTTTTTAATAGG3′, R 5′ACACTCTTTCCCCACACGACGCTCTTCCG ATCTCTAAATTTCTTTACACTTTTTTTTTATTAT3′; IGF2 DMR F 5′TAATTTATTTAGGGTGGTGTT3′, R 5′TCCAAA CACCCCCACCTTAA3′. Primers were designed with adaptor sequences (indicated in italics) at the 5′ end to achieve the amplicon size of ~300 bp required for sequencing. The IGF2 DMR primer set was not modified as this reaction served only as a positive control thus was not sequenced. Bisulfite-converted DNA was purified using the QIAquick® Gel Extraction Kit (QIAGEN, UK). The DNA samples were sent to Inqaba Biotec for sequencing using the MiSeq v3 platform (Illumina®).Quality control on the data was performed using Galaxy software (version 15.10.dev). BiQ Analyzer HiMod (Becker et al.) was then used to determine the methylation levels of the amplified promoters in each treatment relative to the 72 h vehicle-treated cells. [...] Data from qPCR, ChIP and Western blot experiments were analysed by one-way analysis of variance (ANOVA). Comet assay data were analysed by two-way ANOVA. Post hoc Tukey tests were run for multiple comparisons. All statistical analyses were performed using IBM SPSS Statistics version 21. […]

Pipeline specifications

Software tools BiQ Analyzer HiMod, SPSS
Applications Miscellaneous, oxBS/TAB/fCAB/CAB-seq
Organisms Nicotiana tabacum, Homo sapiens
Diseases Neoplasms, Small Cell Lung Carcinoma
Chemicals Mifepristone