BatchPrimer3 statistics

info info

Citations per year

info

Tool usage distribution map

info info

Associated diseases

info

Popular tool citations

chevron_left Conventional primer design chevron_right
Want to access the full stats & trends on this tool?

Protocols

BatchPrimer3 specifications

Information


Unique identifier OMICS_02370
Name BatchPrimer3
Interface Web user interface
Restrictions to use None
Computer skills Basic
Version 1.0
Stability No
Maintained No

Publication for BatchPrimer3

BatchPrimer3 citations

 (172)
library_books

Development of Molecular Markers Linked to Powdery Mildew Resistance Gene Pm4b by Combining SNP Discovery from Transcriptome Sequencing Data with Bulked Segregant Analysis (BSR Seq) in Wheat

2018
Front Plant Sci
PMCID: 5817070
PMID: 29491869
DOI: 10.3389/fpls.2018.00095

[…] itory of Wheat Portal on URGI, INRA, France). The genomic sequences located downstream of the Pm4b-linked SNP marker (2AL71) developed in this study were used as templates to design SSR primers using batchprimer3. Polymorphic SSR markers between the parents and the contrasting DNA bulks were used to construct the genetic linkage map of Pm4b. […]

call_split

Low expression of long noncoding RNA CDKN2B AS1 in patients with idiopathic pulmonary fibrosis predicts lung cancer by regulating the p53 signaling pathway

2018
PMCID: 5835920
PMID: 29541247
DOI: 10.3892/ol.2018.7910
call_split See protocol

[…] 60°C for 60 sec. Data were analyzed using the comparative ∆Cq method () with β-actin as an endogenous reference gene. Primers were designed using Primer (version 5.0; https://wheat.pw.usda.gov/demos/BatchPrimer3/). The primers used were as follows: Cyclin dependent kinase inhibitor (CDKN)2B-antisense RNA 1 (AS1) forward, AACCGGGGAGATCTATTTGG and reverse, GGTGTGGTGTCTCACACCTG; CDKN2A forward, GGCT […]

library_books

Association between sequence variants in panicle development genes and the number of spikelets per panicle in rice

2018
BMC Genet
PMCID: 5769279
PMID: 29334899
DOI: 10.1186/s12863-017-0591-6

[…] for sequencing were designed based on Nipponbare reference genome using Primer3plus []. Four allele-specific primers for MOC1 were designed based on sequence data of 8 representative varieties using BatchPrimer3 [] (Additional file ). Reactions were performed in a total volume of 50 μl and contained 100 ng genomic DNA, 2.5 nM each primer, 2.5 mM dNTPs, 5 μl 10× buffer, and 0.25 unit Ex Taq (Takar […]

library_books

Development of AhMITE1 markers through genome wide analysis in peanut (Arachis hypogaea L.)

2018
BMC Res Notes
PMCID: 5759262
PMID: 29310707
DOI: 10.1186/s13104-017-3121-8

[…] using wet-lab experiment through PCR, and detection in multiple genotypes to support the results. The sequences flanking the AIPs were retrieved, and primers were designed using default parameters of BatchPrimer3 []. AhMITE1 markers were validated by checking the amplicons from DER, VL 1, 110 and 110(S) for the expected size. The seeds of these genotypes were collected from the Department of Genet […]

library_books

Cross species transferability of EST SSR markers developed from the transcriptome of Melilotus and their application to population genetics research

2017
Sci Rep
PMCID: 5738344
PMID: 29263338
DOI: 10.1038/s41598-017-18049-8

[…] s were considered to contain mono-, di-, tri-, tetra-, penta-, and hexa-nucleotides with minimum repeat numbers of ten, six, five, five and five, respectively. The EST-SSR primers were designed using BatchPrimer3, and the designed EST-SSR primers were synthesized by Shanghai Sangon Biological Engineering Technology (Shanghai, China). […]

library_books

New microsatellite markers for population studies of Phytophthora cinnamomi, an important global pathogen

2017
Sci Rep
PMCID: 5732169
PMID: 29247246
DOI: 10.1038/s41598-017-17799-9

[…] owed multiple homologies to different regions in the genome was removed. Only candidate sequences with a single unique location in the genome were further selected for marker development. The program BatchPrimer3 was used to designed primers flanking the SSR regions. Primer pairs were selected based on their compatibilities for PCR and genescan multiplex assays (similar primer annealing temperatur […]


Want to access the full list of citations?
BatchPrimer3 institution(s)
Department of Plant Sciences, University of California, CA, USA

BatchPrimer3 reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review BatchPrimer3