BatchPrimer3 protocols

View BatchPrimer3 computational protocol

BatchPrimer3 statistics

To access cutting-edge analytics on consensus tools, life science contexts and associated fields, you will need to subscribe to our premium service.

Subscribe
info

Citations per year

Citations chart
info

Popular tool citations

chevron_left Conventional primer design chevron_right
Popular tools chart
info

Tool usage distribution map

Tool usage distribution map
info

Associated diseases

Associated diseases

BatchPrimer3 specifications

Information


Unique identifier OMICS_02370
Name BatchPrimer3
Interface Web user interface
Restrictions to use None
Computer skills Basic
Version 1.0
Stability No
Maintained No

Publication for BatchPrimer3

BatchPrimer3 in pipelines

 (11)
2018
PMCID: 5835920
PMID: 29541247
DOI: 10.3892/ol.2018.7910

[…] 60°c for 60 sec. data were analyzed using the comparative ∆cq method () with β-actin as an endogenous reference gene. primers were designed using primer (version 5.0; https://wheat.pw.usda.gov/demos/batchprimer3/). the primers used were as follows: cyclin dependent kinase inhibitor (cdkn)2b-antisense rna 1 (as1) forward, aaccggggagatctatttgg and reverse, ggtgtggtgtctcacacctg; cdkn2a forward, […]

2017
PMCID: 5216375
PMID: 28059169
DOI: 10.1038/srep40066

[…] to the protein sequences of peanut genes using a combination of orthomcl and reciprocal blastp following the reciprocal best hits method as previously described., primers were designed using batchprimer3 v1.0 (http://probes.pw.usda.gov/batchprimer3/). the primer sequences were aligned to a and b genomes using bowtie (-v 2 -i 100 -x 1000) to make sure they had a single hit in the peanut […]

2017
PMCID: 5363057
PMID: 28330454
DOI: 10.1186/s12864-017-3643-4

[…] gt, gh_e22 vs. gm and gh_e22 vs. gd were randomly selected to design flanking primers. these flanking primers were designed from the 150 bp flanking sequences of the 40 randomly selected snps using batchprimer3 [] with an optimal annealing temperature of 57 °c, optimal product size of 200 bp and the remaining parameters at their default settings. the designed primers were synthesized by beijing […]

2017
PMCID: 5589831
PMID: 28883533
DOI: 10.1038/s41598-017-11495-4

[…] and hexa nucleotides and the maximum distance between two markers was set to 100. to confirm the number and exact motifs for each ssr in all cwrd related genes and design primers, we further used batchprimer3 v1.0 (http://batchprimer3.bioinformatics.ucdavis.edu/). to detect the presence of putative mirna target sites, the cds sequences of cwrd related gene families of soybean were analyzed […]

2017
PMCID: 5605536
PMID: 28928460
DOI: 10.1038/s41598-017-12025-y

[…] fold change ≥2., to support the efficacy of gene expression in rna-seq analysis, key genes of sgs and gas biosynthesis were selected for qrt-pcr validation. gene specific primers were designed using batchprimer3 (http://probes.pw.usda.gov/batchprimer3/) and their related information is listed in table . total rna was isolated from leaf tissues of respective phases (lv, lb and lf) followed […]


To access a full list of citations, you will need to upgrade to our premium service.

BatchPrimer3 in publications

 (145)
PMCID: 5817070
PMID: 29491869
DOI: 10.3389/fpls.2018.00095

[…] of wheat portal on urgi, inra, france). the genomic sequences located downstream of the pm4b-linked snp marker (2al71) developed in this study were used as templates to design ssr primers using batchprimer3. polymorphic ssr markers between the parents and the contrasting dna bulks were used to construct the genetic linkage map of pm4b., genomic dna was extracted from the fresh leaf tissues […]

PMCID: 5835920
PMID: 29541247
DOI: 10.3892/ol.2018.7910

[…] 60°c for 60 sec. data were analyzed using the comparative ∆cq method () with β-actin as an endogenous reference gene. primers were designed using primer (version 5.0; https://wheat.pw.usda.gov/demos/batchprimer3/). the primers used were as follows: cyclin dependent kinase inhibitor (cdkn)2b-antisense rna 1 (as1) forward, aaccggggagatctatttgg and reverse, ggtgtggtgtctcacacctg; cdkn2a forward, […]

PMCID: 5769279
PMID: 29334899
DOI: 10.1186/s12863-017-0591-6

[…] for sequencing were designed based on nipponbare reference genome using primer3plus []. four allele-specific primers for moc1 were designed based on sequence data of 8 representative varieties using batchprimer3 [] (additional file ). reactions were performed in a total volume of 50 μl and contained 100 ng genomic dna, 2.5 nm each primer, 2.5 mm dntps, 5 μl 10× buffer, and 0.25 unit ex taq […]

PMCID: 5759262
PMID: 29310707
DOI: 10.1186/s13104-017-3121-8

[…] wet-lab experiment through pcr, and detection in multiple genotypes to support the results. the sequences flanking the aips were retrieved, and primers were designed using default parameters of batchprimer3 []. ahmite1 markers were validated by checking the amplicons from der, vl 1, 110 and 110(s) for the expected size. the seeds of these genotypes were collected from the department […]

PMCID: 5738344
PMID: 29263338
DOI: 10.1038/s41598-017-18049-8

[…] were considered to contain mono-, di-, tri-, tetra-, penta-, and hexa-nucleotides with minimum repeat numbers of ten, six, five, five and five, respectively. the est-ssr primers were designed using batchprimer3, and the designed est-ssr primers were synthesized by shanghai sangon biological engineering technology (shanghai, china)., a total of 550 primer pairs were selected according […]


To access a full list of publications, you will need to upgrade to our premium service.

BatchPrimer3 institution(s)
Department of Plant Sciences, University of California, CA, USA

BatchPrimer3 reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review BatchPrimer3