BayPass statistics

Tool stats & trends

Looking to identify usage trends or leading experts?

BayPass specifications

Information


Unique identifier OMICS_33248
Name BayPass
Alternative name Bayesian population association analysis
Software type Application/Script
Interface Command line interface
Restrictions to use None
Operating system Unix/Linux, Mac OS, Windows
Programming languages Fortran
License CeCILL version 2.1
Computer skills Advanced
Version 2.1
Stability Stable
Maintained Yes

Download


download.png

Versioning


No version available

Documentation


Maintainer


  • person_outline Mathieu Gautier

Publication for Bayesian population association analysis

BayPass citations

 (6)
library_books

Comparative analysis of genetic diversity and differentiation of cauliflower (Brassica oleracea var. botrytis) accessions from two ex situ genebanks

2018
PLoS One
PMCID: 5805252
PMID: 29420661
DOI: 10.1371/journal.pone.0192062

[…] To test the potential impact of selection, we used three outlier tests to identify highly differentiated SNPs. Out of 1,444 tested SNPs without missing data, 12.5% (LOSITAN), 5.5% (Arlequin) and 5% (BayPass) were classified as highly differentiated between the two sets of accessions. The three methods differ in their approach to control for population structure and kinship to reduce the proportio […]

library_books

Genomic Signature of Adaptive Divergence despite Strong Nonadaptive Forces on Edaphic Islands: A Case Study of Primulina juliae

2017
Genome Biol Evol
PMCID: 5751081
PMID: 29272422
DOI: 10.1093/gbe/evx263

[…] BayeScan and BayPass analyses found only one consistent high FST outlier for habitat-specific divergent selection (, online). As to the FST outlier test encompassing all the ten populations, BayeScan analyses sho […]

library_books

Species composition and environmental adaptation of indigenous Chinese cattle

2017
Sci Rep
PMCID: 5700937
PMID: 29170422
DOI: 10.1038/s41598-017-16438-7

[…] Whole genome-scans for adaptive differentiation and association with population-specific co-variables were performed with BayPass 2.1. The underlying models explicitly account for the covariance structure among the population allele frequencies, which make the approach particularly robust to complex demographic histories […]

library_books

A novel locus on chromosome 1 underlies the evolution of a melanic plumage polymorphism in a wild songbird

2017
R Soc Open Sci
PMCID: 5367300
PMID: 28386436
DOI: 10.1098/rsos.160805

[…] tosomal SNPs with less than 95% of missing data.To detect loci displaying a significant association with coloration, we performed an association analysis on the pooled RAD-seq data using the software BAYPASS (v. 2.1) []. We computed the empirical Bayesian p-value (eBPis) and Bayes factors (BF) expressed in deciban units (dB) to determine the level of association of each SNP with the grey/brown tra […]

library_books

The comparative landscape of duplications in Heliconius melpomene and Heliconius cydno

2016
Heredity
PMCID: 5176112
PMID: 27925618
DOI: 10.1038/hdy.2016.107

[…] erior odds >1 have strong support for selection.We also applied a related method that identifies loci subject to selection taking into account associated population/species-specific covariates, using BayPass v2.1 (http://www1.montpellier.inra.fr/CBGP/software/baypass/), for the putative duplications in the Heliconius Set (). The duplication events were considered as dominant binary markers. We use […]

library_books

In vivo evidence for translesion synthesis by the replicative DNA polymerase δ

2016
Nucleic Acids Res
PMCID: 5009730
PMID: 27185888
DOI: 10.1093/nar/gkw439

[…] ite bypass, 17 mer primer (AGCTATGACCATGATTA) annealed with a 49-mer template oligo DNA (AGCTACCATGCCTGCACGAATXAAGCAATTCGTAATCATGGTCATAGCT), where X can be an abasic site were used. For examining CPD baypass, 16 mer primer (CACTGACTGTATGATG) annealed with 30 mer oligo DNA (CTCGTCAGCATC(TT)CATCATACAGTCAGTG), where (TT) can be CPD were used as illustrated in (). The assay was carried out in a reacti […]

Citations

Looking to check out a full list of citations?

BayPass institution(s)
INRA, UMR CBGP (Centre de Biologie pour la Gestion des Populations), Campus International de Baillarguet, Montferriersur-Lez, France ; IBC (Institut de Biologie Computationnelle), Montpellier, France
BayPass funding source(s)
Supported in part by the ERA-Net BiodivERsA2013-48 (EXOTIC), with the national funders Fondation pour la Recherche sur la Biodiversité, Agence Nationale de la Recherche, Ministère de l’Ecologie, du Développement Durable et de l’Energie, BELSPO (for BELgian Science POlicy), PT-DLR, and Deutsche Forschungsgemeinschaft, part of the 2012–2013 BiodivERsA call for research proposals.

BayPass reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review BayPass