BBTools statistics

info info

Citations per year

info

Tool usage distribution map

info info

Associated diseases

info

Popular tool citations

chevron_left Genome assembly Read alignment Spliced read alignment chevron_right
Want to access the full stats & trends on this tool?

Protocols

BBTools specifications

Information


Unique identifier OMICS_17796
Name BBTools
Alternative name BBMap
Software type Package/Module
Interface Command line interface
Restrictions to use None
Operating system Unix/Linux, Mac OS, Windows
Programming languages Java
Computer skills Advanced
Stability Stable
Maintained Yes

Subtools


  • BBDuk
  • BBMask
  • BBMerge
  • BBNorm

Download


download.png
sourceforge.png
conda.png

Versioning


No version available

Documentation


Maintainer


  • person_outline Brian Bushnell

Additional information


https://sourceforge.net/projects/bbmap/

BBTools citations

 (225)
library_books

Multilevel social structure and diet shape the gut microbiota of the gelada monkey, the only grazing primate

2018
Microbiome
PMCID: 5935910
PMID: 29729671
DOI: 10.1186/s40168-018-0468-6

[…] Low quality reads were trimmed and Illumina adapters were removed using Trimmomatic v0.36 [] with default settings. Reads mapping to the PhiX genome (NCBI id: NC_001422.1) were removed using BBMap v36.02 []. De-multiplexing of data based on the dual index sequences was carried out using custom scripts []. Internal barcodes and spacers were removed using cutadapt v1.4.1 [], and paired read […]

library_books

Salmonella enterica Prophage Sequence Profiles Reflect Genome Diversity and Can Be Used for High Discrimination Subtyping

2018
Front Microbiol
PMCID: 5945981
PMID: 29780368
DOI: 10.3389/fmicb.2018.00836

[…] 10.1 with updates available at: http://bioinf.spbau.ru/en/spades (Bankevich et al., ). The raw paired-end Illumina reads were trimmed to a minimum PHRED quality score of Q10 from the 3′ end using the BBDuk tool (http://jgi.doe.gov/data-and-tools/bbtools/). Trimmed reads shorter than 64 bases were discarded and the remainders were merged using BBMerge (http://jgi.doe.gov/data-and-tools/bbtools/). B […]

library_books

Oxygen minimum zone cryptic sulfur cycling sustained by offshore transport of key sulfur oxidizing bacteria

2018
Nat Commun
PMCID: 5928099
PMID: 29712903
DOI: 10.1038/s41467-018-04041-x

[…] Biology, Plön, Germany). Full-length 16S rRNA gene sequences were reconstructed from raw reads using phyloFlash (https://github.com/HRGV/phyloFlash). Adapters and low-quality reads were removed with bbduk (https://sourceforge.net/projects/bbmap/) with a minimum quality value of two and a minimum length of 36, yielding 1 464 909 and 2 143 435 paired-end reads for library preparations from station […]

library_books

The multiple myeloma risk allele at 5q15 lowers ELL2 expression and increases ribosomal gene expression

2018
Nat Commun
PMCID: 5917026
PMID: 29695719
DOI: 10.1038/s41467-018-04082-2

[…] mate risk allele ratios in rs3815768-CT heterozygotes, we counted the two allelic sequences ([C/T]AGCATTCTGAGACGGATTTAGTTTTC, representing the site of rs3815768) in the raw RNA-sequencing reads using BBTools (http://jgi.doe.gov/data-and-tools/bbtools). Exact matches of the variant sequence and its complement were counted. In the German, UK, and US sample sets, the association was done using Matrix […]

library_books

Comparative genomics of bdelloid rotifers: Insights from desiccating and nondesiccating species

2018
PLoS Biol
PMCID: 5916493
PMID: 29689044
DOI: 10.1371/journal.pbio.2004830

[…] lity bases were removed from Illumina data using Skewer v0.2.2 [], and data quality was manually assessed using FastQC v0.11.5 []. Genome coverage was estimated by generating kmer distributions using BBMap ‘kmercountexact’ v36.02 [], and library insert sizes—along with initial genome size estimates—were calculated using SGA ‘preqc’ []. Error correction of reads was performed using BBMap ‘tadpole’ […]

call_split

Draft Genome Sequence of Raoultella ornithinolytica Strain HH3

2018
Genome Announc
PMCID: 5897809
PMID: 29650579
DOI: 10.1128/genomeA.00270-18
call_split See protocol

[…] uenced with the MiSeq platform (Illumina, Inc.) using the version 3 sequencing kit. A total of 1,491,678 paired-end reads (300 bp) were generated.Adapter sequences and low-quality bases were trimmed (bbduk), and overlapping pairs were merged (bbmerge) using the BBtools software suite (http://jgi.doe.gov/data-and-tools/bbtools/). Preprocessed reads were assembled using SPAdes version 3.10.1 () and […]


Want to access the full list of citations?
BBTools institution(s)
LBNL Department of Energy Joint Genome Institute, Walnut Creek, USA
BBTools funding source(s)
This work was supported by the Office of Science of the U.S. Department of Energy under Contract No. DE-AC02-05CH11231.

BBTools review

star_border star_border star_border star_border star_border
star star star star star

Zoe Jelić Matošević

star_border star_border star_border star_border star_border
star star star star star
Desktop
BBtoolkit has almost everything you ever need, so many different tools