BBTools protocols

View BBTools computational protocol

BBTools statistics

To access cutting-edge analytics on consensus tools, life science contexts and associated fields, you will need to subscribe to our premium service.

Subscribe
info

Citations per year

Citations chart
info

Popular tool citations

chevron_left Read alignment Spliced read alignment chevron_right
Popular tools chart
info

Tool usage distribution map

Tool usage distribution map
info

Associated diseases

Associated diseases

BBTools specifications

Information


Unique identifier OMICS_17796
Name BBTools
Alternative name BBMap
Software type Package/Module
Interface Command line interface
Restrictions to use None
Operating system Unix/Linux, Mac OS, Windows
Programming languages Java
Computer skills Advanced
Stability Stable
Maintained Yes

Subtools


  • BBDuk
  • BBMask
  • BBMerge
  • BBNorm

Download


Versioning


Add your version

Documentation


Maintainer


  • person_outline Brian Bushnell <>

Additional information


https://sourceforge.net/projects/bbmap/

BBTools in pipelines

 (87)
2018
PMCID: 5754496
PMID: 29301887
DOI: 10.1128/genomeA.01416-17

[…] 50 bp read length, v2 chemistry) at the dna sequencing facility, department of biochemistry, university of cambridge (cambridge, uk)., raw reads from three individual samples were pre-processed using bbtools () and coassembled using metaspades (). contigs were taxonomically assigned using kaiju () and binned on the basis of gc% and differential coverage using concoct ()., the resulting bins were m […]

2018
PMCID: 5754502
PMID: 29301893
DOI: 10.1128/genomeA.01429-17

[…] built using a modified version of a local pipeline described elsewhere (). to this protocol, adapters and contaminants were removed, and reads were quality filtered with a q score cutoff of 10 using bbduk from the bbmap package version 37.50 (https://sourceforge.net/projects/bbmap). a draft assembly was built using spades version 3.11.0 () (k-mers selected, 21, 33, 55, 77, 99, and 127). contigs […]

2018
PMCID: 5768916
PMID: 29375529
DOI: 10.3389/fmicb.2017.02667

[…] and reverse reads by their common overlapping parts using pear (version 0.9.1) (). quality metrics were checked using fastqc (version 0.11.5) and filtered using tools in fastx (version 0.7) and bbmap (version 35.84). ambiguous and chimeric sequences were identified and removed using vsearch (version 1.4.0) with the ribosomal database project as reference (). all downstream analyses […]

2018
PMCID: 5769311
PMID: 29335008
DOI: 10.1186/s40168-018-0398-3

[…] bases using the fastx toolkit (v0.0.14; http://hannonlab.cshl.edu/fastx_toolkit/). we also filtered out reads < 400 bp or that did not have exact matches to the forward and reverse primers using bbmap (v35.82; https://sourceforge.net/projects/bbmap/). an average of 18.7% of the assembled reads per sample was discarded by these filters. next, we removed chimeric sequences using uchime [] […]

2018
PMCID: 5792456
PMID: 29386569
DOI: 10.1038/s41598-018-20393-2

[…] processed in qiime 1.9.1. first, paired end reads were assembled using pear. quality control and trimming were performed using fastqc (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/) and bbduk (minlength = 75 trimq = 20; http://jgi.doe.gov/data-and-tools/bb-tools/). operational taxonomic units (otus) were clustered with a 97% cutoff using uclust. the national center for biotechnology […]


To access a full list of citations, you will need to upgrade to our premium service.

BBTools in publications

 (237)
PMCID: 5952469
PMID: 29764372
DOI: 10.1186/s12864-018-4751-5

[…] 50 bp nextera libraries in a multiplexed mode. the resulting output was demultiplexed, the quality was checked with fastqc and the reads were trimmed for adaptors and quality (q20 threshold) with the bbduk script (https://jgi.doe.gov/data-and-tools/bbtools/)., sequencing reads, assembly and annotation data have been deposited in genbank under the bioproject prjna428320 and in open science framewor […]

PMCID: 5935910
PMID: 29729671
DOI: 10.1186/s40168-018-0468-6

[…] sheep., low quality reads were trimmed and illumina adapters were removed using trimmomatic v0.36 [] with default settings. reads mapping to the phix genome (ncbi id: nc_001422.1) were removed using bbmap v36.02 []. de-multiplexing of data based on the dual index sequences was carried out using custom scripts []. internal barcodes and spacers were removed using cutadapt v1.4.1 [], and paired […]

PMCID: 5945981
PMID: 29780368
DOI: 10.3389/fmicb.2018.00836

[…] with updates available at: http://bioinf.spbau.ru/en/spades (bankevich et al., ). the raw paired-end illumina reads were trimmed to a minimum phred quality score of q10 from the 3′ end using the bbduk tool (http://jgi.doe.gov/data-and-tools/bbtools/). trimmed reads shorter than 64 bases were discarded and the remainders were merged using bbmerge (http://jgi.doe.gov/data-and-tools/bbtools/). […]

PMCID: 5928099
PMID: 29712903
DOI: 10.1038/s41467-018-04041-x

[…] biology, plön, germany). full-length 16s rrna gene sequences were reconstructed from raw reads using phyloflash (https://github.com/hrgv/phyloflash). adapters and low-quality reads were removed with bbduk (https://sourceforge.net/projects/bbmap/) with a minimum quality value of two and a minimum length of 36, yielding 1 464 909 and 2 143 435 paired-end reads for library preparations from station […]

PMCID: 5917026
PMID: 29695719
DOI: 10.1038/s41467-018-04082-2

[…] risk allele ratios in rs3815768-ct heterozygotes, we counted the two allelic sequences ([c/t]agcattctgagacggatttagttttc, representing the site of rs3815768) in the raw rna-sequencing reads using bbtools (http://jgi.doe.gov/data-and-tools/bbtools). exact matches of the variant sequence and its complement were counted. in the german, uk, and us sample sets, the association was done using […]


To access a full list of publications, you will need to upgrade to our premium service.

BBTools institution(s)
LBNL Department of Energy Joint Genome Institute, Walnut Creek, USA
BBTools funding source(s)
This work was supported by the Office of Science of the U.S. Department of Energy under Contract No. DE-AC02-05CH11231.

BBTools review

star_border star_border star_border star_border star_border
star star star star star

Zoe Jelić Matošević

star_border star_border star_border star_border star_border
star star star star star
Desktop
BBtoolkit has almost everything you ever need, so many different tools