Similar protocols

Protocol publication

[…] Antibody staining and in situ hybridization with intronic probes were as described previously (). Primary antibodies were: mouse βPS integrin, anti-Col (), anti-GFP (Torrey Pines Biolabs), anti-β-galactosidase (Promega, Madison, Wisconsin), rabbit anti-Tin (Manfred Frasch, Erlangen, Germany), anti-Nau (Bruce Paterson, Bethesda, USA), anti-Kr (Ralf Pflanz, Goettingen, Germany), anti-β3-tubulin (Renate Renkawitz-Pohl, Marburg, Germany). Secondary antibodies were: Alexa Fluor 488- and 555-conjugated antibodies (Molecular Probes), and biotinylated goat anti-mouse (Vector Laboratories). Digoxygenin-labelled antisense RNA probes were transcribed in vitro from PCR-amplified DNA sequences, using T7 polymerase (Roche Digoxigenin labelling Kit). For aop, edl and eya-RB, 3 non overlapping 600 nucleotide (nt) probes were pooled together; for noc, a single probe spanning the entire 302 bp intron; for so, a 2771nt probe hydrolyzed to ~600nt fragments (Cox et al., 1984). The primer pairs used to amplify the different intron fragments are listed below, with the T7 promoter indicated by small characters.aop1: CTCATTGTATGCACGGTACGaop1T7: ccgaattctaatacgactcactatagggATAGCTGCGGCAGAAGCAGGaop2: GCAACAGCAACACTCCAATCaop2T7: ccgaattctaatacgactcactatagggAGACGGTGCGGGCAGAAATTGGGaop3: AAGAGAAAGAGCACGGCAAGaop3T7: ccgaattctaatacgactcactatagggAGATCGGCGACGTTCTCCGAGACedl1: GGGAGGTGGAAATGACAAACedl1T7: ccgaattctaatacgactcactatagggCATCGTCTGCCTGACGTCTGedl2: CCAAATATCGCCGATAAGCCedl2T7: ccgaattctaatacgactcactatagggAGACTGCGCACAGGATGCACACCedl3: GAAGATCGACCAGACTTAGGedl3T7: ccgaattctaatacgactcactatagggAGAAGCGGCGTCGAGATTCCCAGeyaRB1: GTTCCTCTAGCTCCGAAATGeyaRB1T7: ccgaattctaatacgactcactatagggTTACGCCGGAGTTGTGAGGGeyaRB2: GACAGCATCGGAGACAACACeyaRB2T7: ccgaattctaatacgactcactatagggCCCGGCCACAAACGAGAAACeyaRB3: AGCCCAGTCAAATGCGAAACeyaRB3T7: ccgaattctaatacgactcactatagggATGCGTGTCCGTGTCGCTACnoc1: CGACGGTTAGTATTGACTAAGnoc1T7: ccgaattctaatacgactcactatagggGGCGTCCATCTGTTATGAATAAAATGso1: TCCACGTTTCCAAGTTGGCTACTCso1T7: ccgaattctaatacgactcactatagggAATGCGGCATGTTCGATGCTCGATAATCGGConfocal sections were acquired on Leica SP5 or SPE microscopes at 40× magnification, 1024/1024 pixel resolution. Images were assembled using ImageJ and Photoshop softwares. 3-D reconstructions of the topology of DL PCs and FCs were made from optimized section, 'using volocity (PerkinElmer) or Imaris (Bitplane) Softwares'. Images presented are representative of observations of at least 10 embryos per genotype at a given stage and between five and six segments per embryo. To compare the size of the Col and Nau expression domains in wt and aop mutants, optimized stacks of double-stained embryos in the same orientation were flattened, and the largest diameter of each domain measured. Statistical analysis was with GraphPad Prism5 using unpaired t-test. […]

Pipeline specifications

Software tools ImageJ, Imaris
Application Microscopic phenotype analysis
Organisms Drosophila melanogaster