Computational protocol: Putrescine-Dependent Re-Localization of TvCP39, a Cysteine Proteinase Involved in Trichomonas vaginalis Cytotoxicity

Similar protocols

Protocol publication

[…] To validate the expression of tvcp39 in different putrescine conditions, RT-PCR analysis were performed using 50 ng cDNA from parasites grown in the absence or presence of 20 mM DAB, or DAB-treated parasites transferred into 40 mM exogenous putrescine medium, 10 pmol of each primer pair and 0.25 U of Taq DNA polymerase (Invitrogen). PCR was carried out in a GeneAmp PCR System 9700 thermal cycler (Applied Biosystems Inc., Foster City, CA, USA). Specific primer pairs were designed using Primer3 software version 3.0 (www.primer3.sourceforge.net). We used the following primer pairs to amplify: 110 bp of the tvcp39 gene (accession number XM_001316379), sense (CP39-FRT) 5′ CAGTATGCTATCACAACAGG 3′ and antisense (CP39-RRT) 5′ CGCCCTGGTGCTTGACAACAT 3′; and 112 bp of the β-tubulin gene as reported . The amplified products were analyzed on 2% agarose gels and visualized by ethidium bromide staining. Gene expression densitometry analyses were performed using the Quantity One Software (BioRad). Data from densitometry quantification of the housekeeping gene (β-tubulin) were used to normalize the results.To further support the semi-quantitative data, qRT-PCR was performed using the SYBR Green (QIAGEN) stain, according to the manufacturer's instructions. Specific primers pairs were used: sense CP39-FRT and antisense CP39-RRT. The reaction was carried out in optical 96-well standard plates (Applied Biosystems). PCR was performed with an initial incubation at 94°C for 3 min, followed by 40 cycles at 94°C for 30 s, 60°C for 30 s, and 72°C for 30 s. The reaction was terminated by a final incubation at the dissociation temperatures. The relative quantification of tvcp39 expression was calculated after the threshold cycle (Ct) and was normalized with the Ct of β-tubulin (β-tub) gene. Furthermore, the expression of tvcp39 in different putrescine conditions was expressed as normalized Ct values. All reactions including no-template and RT minus controls for each mRNA were run in triplicate. All experimental data were expressed as means ± standard deviation (SD) from three separate biological experiments. The significance of the difference between means was determined by ANOVA with Prisma Firewall 1.53 software. The level of significance was also determined by the Bonferroni multiple comparisons test. [...] tvcp39 mRNA stability was monitored in DAB-treated, DAB-putrescine-treated, and untreated parasites using the transcriptional inhibitor actinomycin D (Sigma). Trichomonads were incubated in TYM medium with 50 µg/ml actinomycin D in dimethyl sulfoxide at 37°C. Parasites (2.0×107) were taken at different time-points (0, 1, 3, 6, 8, 12, and 24 h) after transcriptional blockage. Total RNA from trichomonads was extracted by TRIzol, followed by semi-quantitative RT-PCR analysis to detect the presence and stability of tvcp39 mRNA. The tvcp39 and β-tub mRNA levels were analyzed on ethidium bromide–stained agarose gels and quantified by densitometric analysis with the Quantity One software (BioRad). The tvcp39 mRNA levels were normalized with the β-tub mRNA. The experiment was performed by triplicate and the data were used to calculate the half life. The pixels produced by the tvcp39 transcript in trichomonads cultured without treatment (t0) were defined as 100% for each condition to determine the stability time of tvcp39 transcript. The experimental tvcp39 mRNA half-life (the time at which 50% of mRNA molecules remained intact) was determined by the quantity of tvcp39 mRNA at different times. The theoretical half-life of tvcp39 mRNA was obtained from the logarithmically transformed best-fit line by linear regression analysis using the decay equation t½  =  ln 2/K, where K corresponds to the decay constant, using the Sigmaplot program. […]

Pipeline specifications

Software tools Primer3, SigmaPlot
Applications Miscellaneous, qPCR
Organisms Trichomonas vaginalis
Diseases Trichomonas Infections, Drug-Related Side Effects and Adverse Reactions
Chemicals Cysteine, Dactinomycin, Polyamines, Putrescine