Benchling statistics

info info

Citations per year

info

Popular tool citations

chevron_left CRISPR/Cas9 sgRNA design Gene design Primer design chevron_right
info

Tool usage distribution map

Tool usage distribution map
info info

Associated diseases

Associated diseases
Want to access the full stats & trends on this tool?

Benchling specifications

Information


Unique identifier OMICS_04729
Name Benchling
Interface Web user interface
Restrictions to use License purchase required
Computer skills Basic
Stability Stable
Maintained Yes

Maintainer


  • person_outline Benchling Team

Additional information


A registration is needed to access to tools. This software includes a free version and a Professional version.

Benchling citations

 (40)
library_books

Prevalence of Plasmodium falciparum delayed clearance associated polymorphisms in adaptor protein complex 2 mu subunit (pfap2mu) and ubiquitin specific protease 1 (pfubp1) genes in Ghanaian isolates

2018
PMCID: 5848568
PMID: 29530100
DOI: 10.1186/s13071-018-2762-3

[…] of the two genes were sequenced using sanger sequencing.table 1, the sequence data of the isolates were analysed using the clc genomics workbench 10.01 software (qiagen, aarhus, denmark) and benchling.com (california, ca, usa). pf3d7_1218300 and pf3d7_0104300 (plasmodb) were used as reference sequences to detect snps in the pfap2mu and pfubp1 respectively. poor quality sequences […]

library_books

Molecular engineering of antibodies for site specific covalent conjugation using CRISPR/Cas9

2018
Sci Rep
PMCID: 5789018
PMID: 29379029
DOI: 10.1038/s41598-018-19784-2

[…] for crispr modification of the c-terminal end of the antibody, the region near the stop codon at the 3′ end of the exon encoding the c-terminus of the ch3 heavy chain was chosen for sgrna selection. benchling crispr sgrna design tool was used to select two sgrnas, one upstream and one downstream of the stop codon. sgrna 1 (agaaagctctcaggtcctaa) located 27 bp downstream of the end of stop codon […]

library_books

Identification of a biosynthetic gene cluster for the polyene macrolactam sceliphrolactam in a Streptomyces strain isolated from mangrove sediment

2018
Sci Rep
PMCID: 5785472
PMID: 29371699
DOI: 10.1038/s41598-018-20018-8

[…] advanced institute of science and technology (kaist). all cloning steps were carried out using e. coli top10 (invitrogen, us). identification of protospacer sequences in scen was performed using the benchling server. selected scen dna spacer was introduced into pcrispr-cas9 by ligating a pcr-generated sgrna sequence into snabi and ncoi linearized pcrispr-cas9 vector. to generate an 883 bp […]

library_books

Automated Robotic Liquid Handling Assembly of Modular DNA Devices

2017
PMCID: 5755516
PMID: 29286379
DOI: 10.3791/54703

[…] automation friendly protocols that are explicitly scheduled to run on liquid handling robots. though a number of software tools exist that allow researchers to design assemblies in-silico including benchling, moclo planner, and raven, few have the ability to translate those designs into executable instructions to run on a liquid handler. to that end, work such as pr-pr automation and puppeteer […]

library_books

Towards personalised allele specific CRISPR gene editing to treat autosomal dominant disorders

2017
Sci Rep
PMCID: 5701044
PMID: 29170458
DOI: 10.1038/s41598-017-16279-4

[…] table ) were annealed and cloned into the digested plasmid., off-target and on-target scores were calculated using the ‘optimised crispr design tool’, available online by the zhang lab, mit 2013 and ‘benchling’s crispr tool’ available online by benchling., a dual luciferase assay was used to determine the potency and allele specificity of the different guides previously described. hek ad293 cells […]

library_books

A COUP TFII Human Embryonic Stem Cell Reporter Line to Identify and Select Atrial Cardiomyocytes

2017
Stem Cell Reports
PMCID: 5785710
PMID: 29173897
DOI: 10.1016/j.stemcr.2017.10.024

[…] thermo fisher scientific), or on irradiated mouse embryonic fibroblasts in hesc medium ()., the sgrnas (sgrnas 1–3) were designed either with the web tool crispr design (http://crispr.mit.edu) or benchling (https://benchling.com/crispr). oligos containing the sgrna sequences (integrated dna technologies) were cloned into the psp-cas9(bb)-2a-puro vector (px459; addgene) as described previously […]


Want to access the full list of citations?
Benchling institution(s)
Benchling, Inc, CA, USA

Benchling reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review Benchling