BLOCK-iT RNAi Designer statistics

Tool stats & trends

Looking to identify usage trends or leading experts?

Protocols

BLOCK-iT RNAi Designer specifications

Information


Unique identifier OMICS_04737
Name BLOCK-iT RNAi Designer
Interface Web user interface
Restrictions to use None
Computer skills Basic
Stability Stable
Maintained Yes

BLOCK-iT RNAi Designer citations

 (271)
library_books

Inhibition of glutamate oxaloacetate transaminase 1 in cancer cell lines results in altered metabolism with increased dependency of glucose

2018
BMC Cancer
PMCID: 5948873
PMID: 29751795
DOI: 10.1186/s12885-018-4443-1

[…] GOT1 specific siRNAs and mock control siRNA expression plasmids were prepared as described by the manufacturer. Briefly, two specific oligonucleotides were designed using online tools BLOCK-iT™ RNAi designer (http://rnaidesigner.lifetechnologies.com/rnaiexpress/). The siRNA target sequences are 5′---TAGCCTAAATCACGAGTAT---3′ and 5′---TGGACAGGTAATGTGAAGA---3′ respectively. The two co […]

library_books

Knockdown of fibrous sheath interacting protein 1 expression reduces bladder urothelial carcinoma cell proliferation and induces apoptosis via inhibition of the PI3K/AKT pathway

2018
PMCID: 5896667
PMID: 29670371
DOI: 10.2147/OTT.S158275

[…] We utilized the BLOCK-iT™ RNAi Designer Software (Thermo Fisher Scientific) to design FSIP1 shRNA using FSIP1 cDNA from Genbank (NM_152597 with targeting sequence of 5′-GCAGATGCAGAAACTCAAT-3′), whereas a randomly shR […]

library_books

Klf4 glutamylation is required for cell reprogramming and early embryonic development in mice

2018
Nat Commun
PMCID: 5871780
PMID: 29593216
DOI: 10.1038/s41467-018-03008-2

[…] CP1, CCP6, TTLL4, TTLL1, Klf4wt, Klf4E384A mutant, and Klf4K232R mutant were also subcloned into pMY-IRES-GFP vector (Cell Biolabs) for enforced expression. RNA interference was designed according to BLOCK-IT RNAi Designer system instructions (Invitrogen). shRNA oligos encoding target mouse sequences against mKlf4 (5′-GACATCGCCGGTTTATATTGA-3′), mCCP1 (5′-GGAGAACACGAAAGATCTTCA-3′), mCCP6 (5′-CCGAGT […]

library_books

Knockdown delta 5 desaturase in breast cancer cells that overexpress COX 2 results in inhibition of growth, migration and invasion via a dihomo γ linolenic acid peroxidation dependent mechanism

2018
BMC Cancer
PMCID: 5870477
PMID: 29587668
DOI: 10.1186/s12885-018-4250-8

[…] hased from Bethyl Laboratories (TX, USA). All other primary and secondary antibodies were bought from Cell Signaling (MA, USA). X-ray film was purchased from Phoenix Research Products (NC, USA).Using BLOCK-IT™ RNAi Designer (http://www.invitrogen.com/rnai), DNA oligos encoding D5D-targeted shRNA were designed with sequence of TGCTGTAATCATCCAGGCCAAGTCCA GTTTTGGCCACTGACTGACTGGACTTGCTGGATGATTA (top s […]

library_books

The integrated landscape of causal genes and pathways in schizophrenia

2018
PMCID: 5851982
PMID: 29540662
DOI: 10.1038/s41398-018-0114-x

[…] ’s modified Eagle’s medium (DMEM)-F12 (1:1) containing 10% fetal bovine serum (FBS). Short-hairpin RNA (shRNA) sequences targeting to CNTN4, GATAD2A, GPM6A, MMP16, PSMA4, and TCF4 were designed using BLOCK-iT™ RNAi Designer (https://rnaidesigner.thermofisher.com/). Sense and anti-sense oligonucleotides were synthesized, annealed and cloned into the PLKO.1 vector at the AgeI and EcoRI restriction s […]

library_books

A novel transcript isoform of STING that sequesters cGAMP and dominantly inhibits innate nucleic acid sensing

2018
Nucleic Acids Res
PMCID: 5934658
PMID: 29547894
DOI: 10.1093/nar/gky186

[…] Small interfering RNAs (siRNAs) were designed using online siRNA tools of DsiRNA (https://sg.idtdna.com/site/order/designtool/index/DSIRNA_CUSTOM) and BLOCK-iT™ RNAi Designer (https://rnaidesigner.thermofisher.com/rnaiexpress/). siRNAs were transfected into THP-1 cells using Lipofectamine 2000 (Invitrogen) as described previously (,,). All siRNAs we […]

Citations

Looking to check out a full list of citations?

BLOCK-iT RNAi Designer reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review BLOCK-iT RNAi Designer