bzip2 protocols

View bzip2 computational protocol

bzip2 statistics

You need an account to access this content

info

Citations per year

Citations chart
info

Popular tool citations

chevron_left File compression chevron_right
Popular tools chart
info

Tool usage distribution map

Tool usage distribution map
info

Associated diseases

Associated diseases

bzip2 specifications

Information


Unique identifier OMICS_00951
Name bzip2
Software type Package/Module
Interface Command line interface
Restrictions to use None
Input format FASTQ
Output format BZ2
Operating system Unix/Linux
License BSD 2-clause “Simplified” License
Computer skills Advanced
Version 1.0.6
Stability Stable
Source code URL http://www.bzip.org
Maintained Yes

Versioning


Add your version

Maintainer


  • person_outline bzip2 Team <>

bzip2 in pipelines

 (2)
2017
PMCID: 5673197
PMID: 29107972
DOI: 10.1371/journal.pone.0187625

[…] single read sequencing. for qrt-pcr, cdna was generated from the previously collected rna using quantabio qscript cdna supermix kit. primers and thermal cycler conditions for qrt-pcr follow [] for bzip23, bzip72 and [] for vsp2. data was analyzed using the δδct method []., sequence reads were processed with fastx toolkit 0.0.13 [] to remove low quality reads. the high-quality reads […]

2015
PMCID: 4455317
PMID: 26045962
DOI: 10.1186/s13742-015-0058-5

[…] from approximately 10 to 100 gb, which are referred to as datasets s1-s9. all of the data used were standardized to the fastq format and compressed with pbzip2 [] (which is a parallel version of the bzip2) because it provides very good compression and is splittable. this means that the archive can be natively expanded by hadoop using the proper codecs in a massively parallel manner, thereby […]

bzip2 in publications

 (145)
PMCID: 5894230
PMID: 29636001
DOI: 10.1186/s12870-018-1275-8

[…] dichloride (common name: paraquat) [], an herbicide which induces oxidative stress in plants [, ]. this bdbzip10 tf is the homolog of arabidopsis bzip19 and arabidopsis bzip23 tfs, which have been characterized for their role in adaptation to zinc deficiency in arabidopsis. since overexpression of bdbzip10 increases oxidative stress tolerance [], we investigated […]

PMCID: 5883603
PMID: 29615051
DOI: 10.1186/s12964-018-0224-3

[…] nucleus to exert a transcription regulation role (fig. a4). examples are provided to illustrate this mode, including sterol regulatory element-binding protein (srebp), plant bzip tf family protein bzip28 and several activating transcription factor (atf)/camp response element-binding protein (creb) family proteins, such as activating transcription factor 6 (atf6), old astrocyte specifically […]

PMCID: 5864889
PMID: 29616060
DOI: 10.3389/fpls.2018.00348

[…] 6 (atf6), to promote cell survival by restoring er homeostasis (; ). except for perk ortholog, upr pathways mediated by ire1 and atf6 homologs have been identified in plants (e.g., the ire1 and bzip28 pathways in arabidopsis) (; ; ; ). ire1 acts by splicing messenger rna encoding transcription factor xbp1 in mammalian cell or bzip60 in plant cell, respectively, to upregulate genes encoding […]

PMCID: 5877683
PMID: 29534529
DOI: 10.3390/ijms19030822

[…] seeds were germinated on ms medium (murashige and skoog medium) containing 50 mg/l hygromycin for selection. resistant transgenic arabidopsis plants were confirmed by pcr with the primers bzip25-f (cgaccagcagccaaactcta) and bzip25-r (aatccgcccagccacataaa). more than five independent lines of the t2 generation were used for further analysis., histochemical assays for gus activity […]

PMCID: 5839161
PMID: 29545819
DOI: 10.3389/fpls.2018.00270

[…] function in the uptake of zn from the rhizosphere and the distribution of zn among different tissues and cells (). two basic-region leucine-zipper (bzip) type of transcription factors, bzip19 and bzip23 play key roles in regulating the expression of those zip genes in response to zn status ()., the p-type atpase family functions in transport of various cations mainly across membranes […]

bzip2 reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review bzip2