Computational protocol: Expressed Centromere Specific Histone 3 (CENH3) Variants in Cultivated Triploid and Wild Diploid Bananas (Musa spp.)

Similar protocols

Protocol publication

[…] To identify putative genomic sequence of banana CENH3, a nucleotide BLAST (BLASTN) analysis was performed using genomic sequence of A. thaliana CENH3 (At1g01030) against the whole-genome shotgun contigs (wgs) of M. acuminata (tax id: 4641) for “somewhat similar sequences”. In order to identify the exact genomic region of CENH3, consensus sequences from conserved regions at the beginning and end of selected monocot CENH3 CDSs were mapped to the BLASTN hit results. The conserved consensus, which we considered as representative CENH3 ‘landmark’ regions for monocots, were obtained by aligning sequences of CENH3 from the monocots Zea mays (NM_001112050), H. vulgare (JF419328), T. aestivum (JF969285.1) and Oryza sativa (AY438639.1). To identify the genomic regions of the CENH3 from M. acuminata, BLASTN hits, we mapped the CENH3 ‘landmarks’ and regions with >75% nucleotide identities were selected. The primers CENH3_END_F (GGCGAGAACGAAGCATC) and CENH3_END_R (TCACCAATGTCTTCTTCCTCC) were designed to amplify the CDS (from the beginning to the end of the coding region) derived from in silico analysis of the putative banana genomic sequence (Accession: CAIC01023700). [...] Sequences were analyzed in Geneious version 7.1 (Biomatter, NZ) () by manually checking the quality of the chromatograms. Sequences with quality above 50% (based on Phred values) across the entire sequence length were used for analysis. Sequences were further screened and ‘dirty’ sections at the ends were manually trimmed to retain only high quality regions. Sequences within any of the six genotypes that were independently derived (those obtained from amplification of independently synthesized cDNA transcripts) and had 100% similarity were considered to represent the same transcript.Multiple alignments of amino acids were conducted among translated banana CENH3 sequences and monocots (Z. mays, T. aestivum, O. sativa, and H. vulgare) and dicots (A. thaliana and Brassica rapa) in MUSCLE as implemented in Geneious version 7.1 using default parameters. Phylogenetic trees comparing transcript sequences were drawn in the software “Molecular and Evolutionary Genetic Analysis” (MEGA) version 6.0 () based on only the conserved tail sections and entire HFD region. […]

Pipeline specifications

Software tools BLASTN, Geneious, MUSCLE, MEGA
Applications Phylogenetics, WGS analysis, Nucleotide sequence alignment
Organisms Musa acuminata
Chemicals Amino Acids