The E. coli global regulator DksA attenuates transcription during T4 infection

Purpose: We investigated how deletion of DksA or ppGpp, two E. coli global transcription regulators, affects T4 infection. Method: B606, B606 DdksA, and B606 ppGpp0 were grown at 37C to early/mid log phase (OD600 ~ 0.4) then infected with moi of 10 of either wt T4 or T4motAam and total RNA was isolated. 2.5 µg total RNA from each sample was treated with a Ribo-Zero rRNA Removal Kit (Gram-Negative Bacteria; Illumina San Diego, CA) to deplete rRNA. The enriched mRNA was fragmented, reverse-transcribed, ligated with dual indexes, and amplified using a TruSeq Stranded mRNA Library Prep Kit (Illumina, San Diego, CA). The resulting RNA-Seq libraries were pooled at equal concentrations and sequenced using on an Illumina MiSeq to generate 2 x 100 bp paired-end reads. Read data in fastq format was demultiplexed and aligned to E. coli B str. DE3 (NC_012971.2) reference genome using STAR v2.5.2, retaining unmapped reads (Dobin, Davis et al. 2013). Unmapped reads were then mapped in a second step to T4 reference (NC_000866.4). In both cases, default alignment behavior was altered with the following arguments: --outFilterScoreMinOverLread 0 --outFilterMatchNmin 30 --outFilterMatchNminOverLread 0 --clip3pAdapterSeq AGATCGGAAGAGCGTCGTGTA --alignIntronMax 1. RNA gene counts in both reference genomes were then quantified using the same NCBI gene definitions utilized in mapping index construction using the subread featureCounts v1.4.6-p3 package (Liao, Smyth et al. 2014). Differential expression between samples fchanges in gene expression was predetermined to entail a fold change of more than or equal to 2 and P value less than or equal to 0.05. at 5 minutes post-infection. Result: Both ppGpp0 and delta(dksA) increase wt T4 plaque size. However, ppGpp0 does not significantly alter burst size/latent period and only modestly affects T4 transcript abundance, while delta(dskA) increases burst size (2-fold), does not affect latent period, and increases the abundance of several Pe RNAs at 5 min post-transcription. delta(dskA) also increases T4motAam plaque size with a much shorter latent period compared to T4motAam/wt infection, and the levels of specific middle RNAs increase due to more transcription from Pe's that extend into these middle genes. Conclusion: We conclude that DksA attenuates T4 early gene expression. Consequently, delta(dksA) results in a more productive wt infection and ameliorates the poor expression of middle genes in a T4motAam infection.

Dataset features

Information

Specifications

Application:	RNA-seq analysis
Number of samples:	18
Release date:	Mar 15 2018
Last update date:	Jul 11 2018
Access:	Public
Taxon:	Escherichia coli
Dataset link	The E. coli global regulator DksA attenuates transcription during T4 infection

Experimental Protocol

Three strains of E. coli were used to determine the role of dksA and ppGpp in bacteriophage T4 infections: wt, delta(dksA), and ppGpp0. To determine the effect of MotA on global transcription, 2 strains of bacteriophage T4 were used: wt and motAam

Repositories

GEO

GSE111808

ENA

SRP135660

BioProject

PRJNA438226

Download

Contact

Jennifer West