Computational protocol: Therapeutic Targeting of BET Bromodomain Proteins in Castration-Resistant Prostate Cancer

Similar protocols

Protocol publication

[…] Total RNA was isolated from cells using RNeasy Mini Kit (Qiagen) and cDNA was synthesized from 1,000ng total RNA using SuperScript III First-Strand Synthesis SuperMix (Invitrogen). QPCRs were performed in duplicate or triplicate using Taqman assays (Applied Biosystems) or standard SYBR green reagents and protocols on a StepOnePlus Real-Time PCR system (Applied Biosystems). The target mRNA expression was quantified using ΔΔCt method and normalized to GAPDH expression. All primers were designed using Primer 3 (http://frodo.wi.mit.edu/primer3/) and synthesized by Integrated DNA Technologies (Coralville, IA). The primer sequences for the SYBR green and catalogue numbers for TaqMan assays qPCR used are as follows: brd2_qPCR_fwd_CTACGTAAGAAACCCCGGAAG; brd2_qPCR_rev_ GCTTTTTCTCCAAAGCCAGTT; brd3_qPCR_fwd_CCTCAGGGAGATGCTATCCA; brd3_qPCR_rev_ ATGTCGTGGTAGTCGTGCAG; brd4_qPCR_fwd_AGCAGCAACAGCAATGTGAG; brd4_qPCR_rev_ GCTTGCACTTGTCCTCTTCC; erg_qPCR_fwd_CGCAGAGTTATCGTGCCAGCAGAT; erg_qPCR_rev_CCATATTCTTTCACCGCCCACTCC; psa(klk3)_qPCR_fwd_ACGCTGGACAGGGGGCAAAAG; psa(klk3)_qPCR_rev_ GGGCAGGGCACATGGTTCACT; tmprss2_qPCR_fwd_CAGGAGTGTACGGGAATGTGATGGT; tmprss2_qPCR_rev_GATTAGCCGTCTGCCCTCATTTGT; fkbp5_qPCR_fwd_TCTCATGTCTCCCCAGTTCC; fkbp5_qPCR_rev_ TTCTGGCTTTCACGTCTGTG; slc45a3_qPCR_fwd_TCGTGGGCGAGGGGCTGTA; slc45a3_qPCR_rev_CATCCGAACGCCTTCATCATAGTGT; bmpr1b_qPCR_fwd_ CCACCATTGTCCAGAAGACTC; bmpr1b_qPCR_rev_ GCAACCCAGAGTCATCCTCTT; myc_qPCR_fwd_GCTCGTCTCAGAGAAGCTGG; myc_qPCR_rev_GCTCAGATCCTGCAGGTACAA; ar_qPCR_fwd_CAGTGGATGGGCTGAAAAAT; ar_qPCR_rev_GGAGCTTGGTGAGCTGGTAG; etv1_qPCR_fwd_GCAAGAAGGCTTCCTGGCTCAT; etv1_qPCR_rev_CCTTCCCGATACATTCCTGGCT; gapdh_qPCR_fwd_ TGCACCACCAACTGCTTAGC; gapdh_qPCR_rev_ GGCATGGACTGTGGTCATGAG; myc_dis.enh_ChIPPCR_fwd_TGGCAACTTCTGCCTGTGTA; myc_dis.enh_ChIPPCR_rev_CAGGCAGGGAGGAAGTCAAT; myc_upstream_ChIPPCR_fwd_CCAGGACAAATGACCACACA; myc_upstream_ChIPPCR_rev_CCCTTGGCAAACATCAACTT; TaqMan primer-probes tdrd1 _catalogue # Hs00229805_m1; cacna1d_ catalogue # Hs00167753_m1; arhgdib_catalogue # Hs00171288_m1; ndrg1_ catalogue # Hs00608387_m1; vcl_ catalogue # Hs00419715_m1; krt8_ catalogue # Hs01595539_g1; malat1_catalogue # Hs00273907_s1; bcl-xl_ qPCR_ catalogue # Hs00236329_m1; wnt2_ qPCR_ catalogue # Hs00608224_m1; crisp3_qPCR_catalogue # Hs00195988_m1. [...] VCaP, LNCaP, 22RV1 and DU145 cells were treated with 500nM JQ1 for 24 hrs. and total RNA extracted using RNeasy Mini Kit (Qiagen) for gene expression array analysis. For anti-androgen comparative study, VCaP and LNCaP cells were grown in media containing 10% charcoal-striped serum for 48 hrs. followed by pre-treatment with 500nM JQ1, 10μM MDV3100 or 25μM Bicalutamide for 6 hrs. and stimulated with 10nM DHT (androgen) for 18 hrs. Cells treated with only vehicle or 10nM DHT served as controls. For determining the effect of BET inhibitors in isogenic ERG system, RWPE-ERG and PC3-ERG cells were treated with 500nM JQ1 or I-BET762 for 24hrs. Expression profiling was performed using the Agilent Whole Human Genome Oligo Microarray (SantaClara, CA) according to the manufacturer's protocol. All samples were run in technical duplicates or quadruplets against control. Over- and under-expressed gene sets were generated by filtering to include only data points that displayed 2-fold average over- or underexpression (Log ratio with p<0.001) in all hybridizations.Gene Set Enrichment Analysis (GSEA) was performed using the JAVA program (http://www.broadinstitute.org/gsea) as described.The AR target gene signature used in GSEA analysis was generated from common up-regulated genes in VCaP and LNCaP upon DHT treatment and the gene list is as follows, ABCC4, ABHD2, ACSL3, ADARB2, AF349445, AFF4, AI089002, AI207522, AI570240, AK023660, AK025360, AK055915, AK057576, AK074291, AK092594, AK093002, AK098478, AK124281, AK124426, AL533190, AL713762, ALDH1A3, AMAC1L2, ANKRD37, ANXA2, ARSG, ASRGL1, ATP10A, ATP1A1, ATP1A4, ATRNL1, AUTS2, AW029229, AW389914, AZGP1, B3GAT1, BC039021, BC041926, BC041955, BC055421, BC062780, BG462058, BG618474, BI710972, BM469851, BMPR1b, BQ017638, BQ706262, BRP44, BU567141, BU753102, BX099483, C10orf114, C14orf162, C16orf30, C18orf1, C1orf108, C1orf113, C1orf26, C20orf112, C6orf81, CA314451, CA414006, CBLL1, CCDC4, CDC14b, CDC14c, CDYL2, CEBPd, CENPN, ChGn, CHIA, CHKA, CHST2, CLDN12, CLDN14, CLDN8, CTBP1, CUTL2, CXorf9, CYP1A1, CYP2U1, DDR2, DHCR24, DKFZp761P0423, DNAJB9, DOCK11, DOCK8, EAF2, EDG7, ELL2, ELOVL5, ELOVL7, EMP1, ENDOD1, ENST00000358356, ERN1, ERRFI1, F2RL1, FAM13A1OS, FER1L3, FGD4, FKBP5, FLJ31568, FLJ39502, FRK, FZD5, GADD45G, GIPR, GREB1, GSR, HERC3, HLA-DRB3, HOMER2, HPGd, HS3ST4, HSD17B2, IFI6, IGF1, IGF1R, IL20RA, IMPAD1, INPP4b, KCNMA1, KLF15, KLK3, KLK4, KLK5, KRT18, KRT19, KRT72, LAMA1, LDLR, LIFR, LOC205251, LOC401708, LOC641467, LOC646282, LOC730498, LONRF1, LOX, LRCH1, LRIG1, LSS, MAf, MAK, MALT1, MAP1b, MAP7D1, MBOAT2, MFSD2, MICAL1, MLPH, MOGAT2, MPZL1, MTMR9, NANOGP1, NAT1, NCAPD3, NDFIP2, NDRG1, NEBL, NEK10, NFKBIA, NNMT, NR4A1, NY-REN-7, ODC1, OLAH, ORM1, ORM2, OTUD7b, PACS1, PDLIM5, PECI, PER1, PFKFB2, PGc, PHACTR3, PNPLA8, PPP2Cb, RAB27A, RAB4A, RASD1, RHOU, RUNX1, S100A5, SCRG1, SGK, SHROOM3, SLC16A6, SLC26A2, SLC26A3, SLC2A14, SLC2A3, SLC38A4, SLC41A1, SLC45A3, SLITRK6, SMC4, SMOC1, SNAI2, SNTG2, SOCS2, SPDEf, SPDYA, SPINK5L3, SPOCK1, SPTb, ST6GALNAC1, STEAP4, STK17b, TACC1, TBRG1, TBX15, TG, TGFB2, TIPARP, TLOC1, TMCC3, TMPRSS2, TNFAIP3, TPD52, TRIM36, TRIM63, TTN, TUBA3d, WIPI1, WNT7b, WWTR1, X03757, ZBTB1, ZBTB16 and ZBTB24.The ERG gene signature was generated by extracting 2-fold upregulated genes from RWPE and PC3 cells stably expressing ERG compared to respective LacZ expressing cells. GSEA was performed using this gene set on gene expression data obtained from the JQ1 and I-BET762 treated RWPE and PC3 cells. We also ran GSEA using gene set that was not changed upon expression of ERG to exclude the possibility that treatment with JQ1 and I-BET762 may change gene expression in a non-specific fashion. All of the gene expression array data (total 48) can be found at GEO # GSE55064. […]

Pipeline specifications

Software tools Primer3, chipPCR, GSEA
Applications Gene expression microarray analysis, qPCR
Organisms Mus musculus, Homo sapiens
Diseases Neoplasms, Prostatic Neoplasms