Dataset features

Specifications

Application:	Gene expression microarray analysis
Number of samples:	12
Release date:	Nov 8 2007
Last update date:	Jul 6 2016
Access:	Public
Dataset link	The embryonic muscle transcriptome of C. elegans

Experimental Protocol

Approximately 80 one- and two-cell stage embryos were collected from either heat-shock hlh-1 (KM267) or heat-shock pal-1(JA1179) worms and were incubated for 20 min (hs pal-1) or 60 min (hs hlh-1) at room temperature prior to a heat pulse at 34oC for 30min. After the heat pulse, embryos were incubated at room temperature for 2, 4, and 6 hours (hs hlh-1) or 2, 4, 6, and 8 hours (hs pal-1) prior to total RNA isolation. Embryos were also collected prior to heat shock as a control (0 hour). Triplicate independent samples were prepared for all time points. All hs pal-1 experiments were performed on embryos derived from skn-1, pop-1 double RNAi injected animals. The isolation of total RNA from embryos followed the procedures in (Baugh et al. 2003). Total RNA was used with the Super Smart PCR cDNA synthesis kit (BD Clontech) in 20 cycles with a modified primer (SMART7T27 Primer: 5'-TGAAGCAGTGGTAACAACGCAGAGTAATACGACTCACTATAGGGAGAAGC(T)27VN -3') prior to one cycle target labeling reaction by standard procedures (Affymetrix). Affymetrix C. elegans gene chips (P/N900383, ~22,500 transcript probes) were processed according to manufactures protocol using the NIDDK Genomics Core Laboratory. Microarray data was normalized by MAS5 prior to analysis using GeneSpring software (Silicon Genetics).