Computational protocol: Sequence of a Complete Chicken BG Haplotype Shows Dynamic Expansion and Contraction of Two Gene Lineages with Particular Expression Patterns

Similar protocols

Protocol publication

[…] Amplifications in Cambridge were performed using a DNA Engine Tetrad 2 Peltier thermocycler (BioRad) using three commercial kits with buffers supplied and according to manufacturer's instructions.For the experiment in , fragments were amplified from BACs P1(26)F6, 34 and P1(186)B6 using 2 ng DNA, 0.6 mM each of the primers uc74 (CTCCTGCCTTATCTCRTGGCTCTGCAC), and uc76 (CACAGCCAGAGCCACYKTCCAG), with 1 U Velocity polymerase (Bioline BIO-21098) in 1×GC rich buffer containing 2 mM MgCl2 and 0.04 mM of each dNTP, with the annealing step being 2 min at 53°C.For the experiment in , genomic DNA was isolated from erythrocytes using a salting-out procedure, as described . Fragments were amplified from 2 ng line C-B12 genomic DNA using 0.2 mM each primer uc244 (F10: TTGGGGAAATAGTGTGACCG) with uc250 (R18: GGAGGGATCAGGAGGGAGC) or uc248 (R11: GGGGGGAAGAATTTAGGGAT) with 0.5 U recombinant Taq DNA polymerase (Invitrogen 10342020) in 1× Invitrogen PCR reaction buffer, 2 mM added MgCl2 and 0.25 mM of each dNTP. After initial denaturation, there were 5 cycles of 0.75 min at 95°C, 0.5 min at 60°C and 1.5 min at 72°C, followed by 30 cycles of 0.75 min at 95°C, 1 sec at 60°C and 1.5 min at 72°C, followed by a final extension step.For the experiment in , fragments were amplified from 1 µl (concentration unknown) line N genomic DNA using 0.4 mM of each primer [Pair 1: uc511 (BG0_P1F, TGCCCAGGGATGATTGTGAGGCT) and uc512 (BG0_P1R, TGCAGAACTGGGTGAGTCGTTCC); Pair 2: uc513 (BG0_P2F, TGCCCAGGGATGATTGTGAGGC) and uc514 (BG0_P2R, TGCAGAACTGGGTGAGTCGTTCCT); Pair 3: uc515 (BG0_P3F, GCCCAGGGATGATTGTGAGGCT) and uc516 (BG0_P3R, GCAGAACTGGGTGAGTCGTTCCT)], with 20 U Phusion polymerase (New England Biolabs #M0530S) in 1× HiFi buffer (containing 1.5 mM MgCl2), 1.5% polyethylene glycol and 0.04 mM of each dNTP. After initial denaturation, there were 5 cycles of 0.75 min at 95°C, 0.5 min at 59.8°C and 1.5 min at 72°C, followed by 30 cycles of 0.75 min at 95°C, 1 sec at 59.8°C and 1.5 min at 72°C, followed by a final extension step.The amplicons were cloned using the CloneJET kit (Fermentas) following manufacturer's instructions, and sequenced using commercial fluorescent dye kits followed by capillary electrophoresis at the DNA Sequencing Facility of the Department of Biochemistry, University of Cambridge (www2.bioc.cam.ac.uk/~pflgroup/DNA_Facility).Sequence data was analyzed using CLC DNA workbench (version 5.7.1, www.clcbio.com/). Alignments were performed using ClustalX (www.clustal.org/) and MAFFT (http://mafft.cbrc.jp/alignment/software/). Some phylogenetic trees were created using the neighbour joining (NJ) method implemented by ClustalX with 1000 bootstrap seeds. Other trees were created using a Bayesian approach implemented by MrBayes (version 3.1.2, http://mrbayes.sourceforge.net/), with the GTR substitution model used with gamma-distributed rate variation across sites, and with the MCMC analysis using one chain, 20000 generations and sampling every 100 generations. Still other trees were created maximum parsimony (MP) phylogenies, using PAUP 4.0b10 for Unix (www.paup.csit.fsu.edu/). AU and SH tests on MP trees were performed in CONSEL version 0.2 (www.is.titech.ac.jp/~shimo/prog/consel/). Finally, other trees were created using neighbour network analysis implemented by SplitsTree4 , (http://www.splitstree.org/), and tested for significance using a Phi test for recombination . Phylogenetic trees were visualized using Dendroscope (http://ab.inf.uni-tuebingen.de/software/dendroscope/). After removal of gaps in the alignment of all 14 BG genes by G-blocks using default stringent parameters , , an automated partitioning analysis performed using SAGUARO (www.sourceforge.net/projects/saguarogw/) gave cacti which were handled with PHYLIP version 1∶3.68-2 from the Ubuntu repositories (www.launchpad.net/ubuntu/lucid/+source/phylip/1∶3.68-2). Dotplots were created with a wordsize of 150, using dottup from the EMBOSS package (version 6.1.0-5, http://emboss.sourceforge.net/). Helical wheels were created using pepwheel from the EMBOSS package (version 6.1.0-5, http://emboss.sourceforge.net/). Read-through exons were found using an in-house Visual BASIC script, and the ITIMs by an in-house PERL script, both written by J. Chattaway.The 21 nucleotide repeats were grouped using an in-house rule based clustering algorithm (J. Chattaway). The clustering algorithm first created a distance matrix between the nucleotide sequences of all the 21 nucleotide repeats. Then, the algorithm created a list of 21 nucleotide repeats that were at least 80% identical to each repeat, and compared the lists and placed repeats that were similar to the same sets of repeats into the same group, again with an 80% identity threshold. The number of resulting groups was small enough to be checked manually; some groups were merged or split, and each group was given a number as a label, in order from the largest to the smallest group. […]

Pipeline specifications

Software tools CLC Assembly Cell, Clustal W, MAFFT, MrBayes, PAUP*, CONSEL, SplitsTree, Dendroscope, SaguaroGW, PHYLIP, EMBOSS
Application Phylogenetics
Organisms Gallus gallus, Homo sapiens