Computational protocol: Glucocerebrosidase Deficiency in Drosophila Results in α-Synuclein-Independent Protein Aggregation and Neurodegeneration

Similar protocols

Protocol publication

[…] Publicly available stocks with Minos transposon insertions in dGBA1a (Mi{ET1}[]CG31148[MB02296]) and dGBA1b (Mi{ET1}[]CG31414[MB03039]) were used in combination with a source of transposase to create deletions that include the coding sequences of dGBA1a and dGBA1b. The following primers spanning the Minos transposon insertions in CG31414 and CG31148 were used to screen over 200 different lines created by transposase-mediated mutagenesis:CG31148Forward ACACCGGAGCAGTGGAATACReverse GTCGGAGCTTTTTGAACTCGCG31414Forward CGCAACAATTCGCTGAACTACReverse TGTTTGGGTCAAAAACAGCAWhole genome sequencing using 100-bp paired-end reads on the Illumina HiSeq2000 platform was used to map the exact breakpoints of the GBA1ΔTT allele. Specifically, reads were aligned and processed against r5.43 of the D. melanogaster genome using BWA and Samtools. Breakpoints were confirmed by visual inspection using the Integrated Genome Viewer. […]

Pipeline specifications

Software tools BWA, SAMtools, IGV
Application Genome data visualization
Organisms Drosophila melanogaster, Homo sapiens
Diseases Gaucher Disease, Parkinson Disease, Neurodegenerative Diseases, Lewy Body Disease, Drug-Related Side Effects and Adverse Reactions