chipPCR statistics

To access cutting-edge analytics on consensus tools, life science contexts and associated fields, you will need to subscribe to our premium service.

Subscribe
info

Citations per year

Citations chart
info

Popular tool citations

chevron_left Data analysis chevron_right
Popular tools chart
info

Tool usage distribution map

Tool usage distribution map
info

Associated diseases

Associated diseases

chipPCR specifications

Information


Unique identifier OMICS_08472
Name chipPCR
Software type Package/Module
Interface Command line interface
Restrictions to use None
Operating system Unix/Linux, Mac OS, Windows
Programming languages R
License GNU General Public License version 2.0
Computer skills Advanced
Version 0.0.8-10
Stability Stable
Requirements
methods
Maintained Yes

Versioning


Add your version

Documentation


Maintainer


  • person_outline Stefan Rödiger <>

Publication for chipPCR

chipPCR in publications

 (3)
PMCID: 5818393
PMID: 29497603
DOI: 10.3389/fcimb.2018.00043

[…] determine tt from growth curves and allow for further correlation to log(cfu) on the basis of calibration curves or calculation of vcc and invasion rates, respectively. alternatively, the r package “chippcr” (rödiger et al., ) was used to analyze the raw data. with “chippcr” a linear background function was calculated using the “least” method from a data window within the lag phase […]

PMCID: 5129434
PMID: 27920994
DOI: 10.1016/j.bdq.2014.08.002

[…] (e.g., cq value calculation) of the qpcr package while other functionality for preprocessing (e.g., removal of missing values, data transformation) and melting curve analysis is derived from the chippcr and the mbmca packages. the chippcr package contains functions to perform background subtraction, to simulate qpcrs, and to detect the start of an amplification reaction. furthermore, […]

PMCID: 4075966
PMID: 24759320
DOI: 10.1038/nature13229

[…] ar_qpcr_rev_ggagcttggtgagctggtag; etv1_qpcr_fwd_gcaagaaggcttcctggctcat; etv1_qpcr_rev_ccttcccgatacattcctggct; gapdh_qpcr_fwd_ tgcaccaccaactgcttagc; gapdh_qpcr_rev_ ggcatggactgtggtcatgag; myc_dis.enh_chippcr_fwd_tggcaacttctgcctgtgta; myc_dis.enh_chippcr_rev_caggcagggaggaagtcaat; myc_upstream_chippcr_fwd_ccaggacaaatgaccacaca; myc_upstream_chippcr_rev_cccttggcaaacatcaactt; taqman primer-probes […]


To access a full list of publications, you will need to upgrade to our premium service.

chipPCR institution(s)
Faculty of Natural Sciences, Brandenburg University of Technology Cottbus–Senftenberg, Senftenberg, Germany
chipPCR funding source(s)
This work was funded by the Federal Ministry of Education and Research (BMBF) InnoProfile–Transfer–Projekt 03 IPT 611X.

chipPCR reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review chipPCR