CLC Main Workbench statistics

Tool stats & trends

Looking to identify usage trends or leading experts?

Protocols

CLC Main Workbench specifications

Information


Unique identifier OMICS_01813
Name CLC Main Workbench
Software type Package/Module
Interface Command line interface, Graphical user interface
Restrictions to use License purchase required
Operating system Unix/Linux, Mac OS, Windows
License Commercial
Computer skills Medium
Version 7.8.1
Stability Stable
Maintained Yes

Versioning


No version available

Documentation


Additional information


Access available upon request. A free trial is available on the site upon request.

CLC Main Workbench citations

 (314)
library_books

CD47 ligation induced cell death in T acute lymphoblastic leukemia

2018
PMCID: 5945676
PMID: 29748606
DOI: 10.1038/s41419-018-0601-2

[…] s was confirmed by sequencing the genomic amplicon generated by polymerase chain reaction (PCR) using the primers: 5′GACAGGAACGGGTGCAATGA3’ and 5′TAATTTTTGCGCGAGGTGCG3′. Analyses were performed using CLC Main Workbench (CLC Bio) by alignment of CRISPR mutants to the parental amplicon sequence.The expression construct for CD47 isoform 4 (pKS336-hCD47iso4) was provided by Dr. Ohdan (University of Hi […]

library_books

A Go type opsin mediates the shadow reflex in the annelid Platynereis dumerilii

2018
BMC Biol
PMCID: 5904973
PMID: 29669554
DOI: 10.1186/s12915-018-0505-8

[…] The sequence alignment and tree calculation was performed using CLC Main Workbench, version 7.7.1. The alignment settings were as follows: gap open costs 10, gap extension costs 1, end gap costs as any other, very accurate alignment; settings tree: method UPGMA, p […]

call_split

Case based surveillance of measles in Sicily during 2012 2017: The changing molecular epidemiology and implications for vaccine strategies

2018
PLoS One
PMCID: 5884552
PMID: 29617454
DOI: 10.1371/journal.pone.0195256
call_split See protocol

[…] he Big Dye Terminator chemistry v3.1 (Applied Biosystems), and then analysed by an automatic genetic analyser ABI PRISM 3130xl (Applied Biosystems). Sequences were assembled with the software package CLC Main Workbench v7.6.13 and aligned with Clustal X []. Moreover, alignments were manually edited when needed using BioEdit v7.2.6 [http://www.mbio.ncsu.edu/BioEdit/bioedit.html].The evolutionary mo […]

call_split

Fungal Diversity and Community Composition of Culturable Fungi in Stanhopea trigrina Cast Gibberellin Producers

2018
Front Microbiol
PMCID: 5893766
PMID: 29670591
DOI: 10.3389/fmicb.2018.00612
call_split See protocol

[…] od with the Jukes Cantor nucleotide substitution model. The analysis involved 45 nucleotide sequences with a total of 100 replicates in the bootstrap analysis. Evolutionary analyses were conducted in CLC Main Workbench 7.9.1. […]

library_books

Unexpected conservation of the RNA splicing apparatus in the highly streamlined genome of Galdieria sulphuraria

2018
BMC Evol Biol
PMCID: 5880011
PMID: 29606099
DOI: 10.1186/s12862-018-1161-x

[…] es of alternatively spliced modules that showed statistically significant difference between high and low temperatures (Fig. ) were visualized using CLC workbench (v8) (http://www.clcbio.com/products/clc-main-workbench/). […]

library_books

Gene Duplication and Transference of Function in the paleoAP3 Lineage of Floral Organ Identity Genes

2018
Front Plant Sci
PMCID: 5876318
PMID: 29628932
DOI: 10.3389/fpls.2018.00334

[…] paleoAP3-1 and paleoAP3-2 orthologs of other available Ranunculaceae. Sequences were retrieved from GenBank and Phytozome (Supplementary Table and Supplementary Figure ), aligned using MUSCLE () and CLC Main Workbench 7 (Qiagen), and homologous regions to the T. thalictroides AP3 binding sites were identified. […]

Citations

Looking to check out a full list of citations?

CLC Main Workbench institution(s)
QIAGEN Aarhus, Aarhus C, Denmark

CLC Main Workbench reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review CLC Main Workbench