CLC Main Workbench protocols

View CLC Main Workbench computational protocol

CLC Main Workbench statistics

To access cutting-edge analytics on consensus tools, life science contexts and associated fields, you will need to subscribe to our premium service.

Subscribe
info

Citations per year

Citations chart
info

Popular tool citations

chevron_left Conventional primer design Differential expression detection Trace visualization/edition chevron_right
Popular tools chart
info

Tool usage distribution map

Tool usage distribution map
info

Associated diseases

Associated diseases

CLC Main Workbench specifications

Information


Unique identifier OMICS_01813
Name CLC Main Workbench
Software type Package/Module
Interface Command line interface, Graphical user interface
Restrictions to use License purchase required
Operating system Unix/Linux, Mac OS, Windows
License Commercial
Computer skills Medium
Version 7.8.1
Stability Stable
Maintained Yes

Versioning


Add your version

Documentation


Additional information


Access available upon request. A free trial is available on the site upon request.

CLC Main Workbench in pipelines

 (114)
2018
PMCID: 5806058
PMID: 29435426
DOI: 10.4102/ajlm.v7i1.658

[…] for 30 seconds and extension at 72°c for 45 seconds. sanger sequencing was performed by inqaba biotechnical industries (pretoria, south africa) in both directions on all 60 amplified products. the clc main workbench software program v6.0 (clcbio, waltham, massachusetts, united states) was used to analyse the sequences against the ncbi reference sequence ng_009904., lna, locked nucleic acid., […]

2018
PMCID: 5829090
PMID: 29527172
DOI: 10.3389/fphys.2018.00100

[…] orffinder https://www.ncbi.nlm.nih.gov/orffinder/). amino acid sequences were identified by blasting against ncbi (https://blast.ncbi.nlm.nih.gov/blast.cgi) and the transcriptomes available by using clc main workbench v6. primers were designed also using clc main workbench v6 considering cg or gc ratio >55%, a fragment length between 100 and 250 bp. candidate primer pairs were double checked […]

2018
PMCID: 5830536
PMID: 29445034
DOI: 10.1098/rsob.170253

[…] intensities and background signal intensity was subtracted., protein sequences were fetched using blast (basic local alignment search tool) and aligned with the clustalw algorithm in the program clc main workbench 7 (v. 7.6.4 clc bio, qiagen, aarhus, denmark)., to analyse phosphorylation sites on stil, 3 × 106 hek 293 t cells were transfected for 48 h with flag-stil fl [], collected […]

2018
PMCID: 5876318
PMID: 29628932
DOI: 10.3389/fpls.2018.00334

[…] and paleoap3-2 orthologs of other available ranunculaceae. sequences were retrieved from genbank and phytozome (supplementary table and supplementary figure ), aligned using muscle () and clc main workbench 7 (qiagen), and homologous regions to the t. thalictroides ap3 binding sites were identified., in order to identify the alpha helices known to be critical for mads box gene […]

2018
PMCID: 5882046
PMID: 29558872
DOI: 10.1177/1533033818764499

[…] were processed using the deva 1.2 software (roche applied science). fluorescence intensities were normalized using the rma algorithm, and all data obtained were subsequently analyzed using the clc main workbench version 7.0.3 software (qiagen). intensities of sensitive versus resistant samples were compared and the genes were considered differentially expressed when the intensities showed […]


To access a full list of citations, you will need to upgrade to our premium service.

CLC Main Workbench in publications

 (433)
PMCID: 5945676
PMID: 29748606
DOI: 10.1038/s41419-018-0601-2

[…] was confirmed by sequencing the genomic amplicon generated by polymerase chain reaction (pcr) using the primers: 5′gacaggaacgggtgcaatga3’ and 5′taatttttgcgcgaggtgcg3′. analyses were performed using clc main workbench (clc bio) by alignment of crispr mutants to the parental amplicon sequence., the expression construct for cd47 isoform 4 (pks336-hcd47iso4) was provided by dr. ohdan (university […]

PMCID: 5946011
PMID: 29780384
DOI: 10.3389/fimmu.2018.00912

[…] using exosap-it (thermo fisher scientific). the products were then sequenced in both direction using the sanger sequencing technique as above. the sequence traces were assembled and analyzed using clc main workbench v7.8.1 (qiagen)., the lab-adapted x4-tropic clade b strain hiv-1 iiib was obtained from the nibsc cfar, then prepared by propagation in c8166 cells as previously described (). […]

PMCID: 5915591
PMID: 29691454
DOI: 10.1038/s41598-018-24674-8

[…] dna from 14 serovars belonging to six species; l. interrogans, l. borgpetersenii l. kirschneri, l. alexanderi, l. weilli and l. biflexa as described earlier. the coding sequences were aligned using clc main workbench (version 7.9.1), based on the clustalw algorithm. the protein sequence of reca (agw25358) and flid (wp_001110738) were retrieved from genbank and subjected for b-cell and t-cell […]

PMCID: 5904973
PMID: 29669554
DOI: 10.1186/s12915-018-0505-8

[…] with a shimadzu uv-2450 spectrophotometer (shimadzu, kyoto, japan). during the spectral measurement, the samples were kept at 10 °c., the sequence alignment and tree calculation was performed using clc main workbench, version 7.7.1. the alignment settings were as follows: gap open costs 10, gap extension costs 1, end gap costs as any other, very accurate alignment; settings tree: method upgma, […]

PMCID: 5893766
PMID: 29670591
DOI: 10.3389/fmicb.2018.00612

[…] with the jukes cantor nucleotide substitution model. the analysis involved 45 nucleotide sequences with a total of 100 replicates in the bootstrap analysis. evolutionary analyses were conducted in clc main workbench 7.9.1., pure fungal isolates were incubated in 5 ml of ici medium, a medium with a low concentration of nitrogen that allows the production of gibberellins, for 10 days at 30°c […]


To access a full list of publications, you will need to upgrade to our premium service.

CLC Main Workbench reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review CLC Main Workbench