CloudMap statistics

To access cutting-edge analytics on consensus tools, life science contexts and associated fields, you will need to subscribe to our premium service.

Subscribe
info

Citations per year

Citations chart
info

Popular tool citations

chevron_left Genetic mapping chevron_right
Popular tools chart
info

Tool usage distribution map

Tool usage distribution map
info

Associated diseases

Associated diseases

CloudMap specifications

Information


Unique identifier OMICS_05849
Name CloudMap
Software type Framework/Library
Interface Command line interface
Restrictions to use None
Operating system Unix/Linux
Parallelization MapReduce
Computer skills Advanced
Stability Stable
High performance computing Yes
Maintained Yes

Download


Versioning


Add your version

Maintainer


  • person_outline Gregory Minevich <>

Publication for CloudMap

CloudMap in publications

 (27)
PMCID: 5765345
PMID: 29301976
DOI: 10.1534/g3.117.300132

[…] mapping to the right arm of chromosome i (+5.06–+9.23 cm), ot280 was whole-genome sequenced using an illumina platform, followed by data analysis initially using maqgene () and then reanalysis with cloudmap (). data were filtered as previously described (). as a general rule, all mutant alleles were backcrossed a minimum of three times., the ztf-6::gfp reporter strain otex6298 [ztf-6::gfp; […]

PMCID: 5919755
PMID: 29237702
DOI: 10.1534/g3.117.300135

[…] paired-end libraries were prepared for each strain and sequenced on an illumina hiseq 2000. resulting reads were analyzed via ssm as described in the results. briefly, our workflow was adapted from cloudmap and incorporated tools including trimmomatic, bwa, samtools, genome analysis toolkit (gatk), generate pileup, varscan, snpeff, snpsift, and integrative genomics viewer implemented […]

PMCID: 5690688
PMID: 29108019
DOI: 10.1371/journal.pbio.2002429

[…] equilibrated and a constant flow of gas co2 was achieved. whole genome sequencing was performed using various illumina platforms at 20- to 30-fold genome coverage and mapping was performed using the cloudmap pipeline on galaxy []. lin-22(icb38) was backcrossed 4 times before phenotypic characterization. the ot269 mutation is a c to t change at −4,940 from lin-22 atg (ttttatcttgatttacgtgt). […]

PMCID: 5587906
PMID: 28874467
DOI: 10.1128/mBio.00940-17

[…] 50 f2 progenies that had the viro phenotype and that did not support orsay virus replication (data not shown) were identified. the f3 progenies were pooled, sequenced, and analyzed using the cloudmap bioinformatic pipeline (). typical mutations introduced by ems were found in the linked region on chromosome x, including a c-to-t nonsense mutation in the coding region of the sid-3 […]

PMCID: 5560668
PMID: 28817611
DOI: 10.1371/journal.pone.0183049

[…] the ev821 ventral clear patch (vcp) phenotype. forty-seven homozygous ev821 f3 lines were grown by self-fertilization and dna was made from each line. dnas were pooled for wgs at 30x coverage. the cloudmap program [] was used to localize the genomic regions enriched for bristol (non-hawaiian) strain dna. bristol dna was found to be greatly enriched relative to hawaiian dna in only one region […]


To access a full list of publications, you will need to upgrade to our premium service.

CloudMap institution(s)
Department of Biochemistry and Molecular Biophysics, Howard Hughes Medical Institute, Columbia University Medical Center, New York, NY, USA

CloudMap reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review CloudMap