CONDEX statistics

To access cutting-edge analytics on consensus tools, life science contexts and associated fields, you will need to subscribe to our premium service.

Subscribe
info

Citations per year

Citations chart
info

Popular tool citations

chevron_left CNV detection chevron_right
Popular tools chart
info

Tool usage distribution map

Tool usage distribution map
info

Associated diseases

Associated diseases

CONDEX specifications

Information


Unique identifier OMICS_05442
Name CONDEX
Alternative name condr
Software type Application/Script
Interface Command line interface
Restrictions to use None
Operating system Mac OS
Programming languages Java
License GNU General Public License version 3.0, GNU General Public License version 2.0
Computer skills Advanced
Stability Stable
Maintained Yes
Wikipedia https://code.google.com/archive/p/condr/wikis/RunningCONDEX.wiki

Download


Versioning


Add your version

Documentation


Maintainers


  • person_outline Itsik Pe'er <>
  • person_outline Arthi Ramachandran <>
  • person_outline Mariann Micsinai <>

Additional information


https://code.google.com/archive/p/condr/wikis/ConversionfromPileup.wiki

Publication for CONDEX

CONDEX in publications

 (4)
PMCID: 5491852
PMID: 28713395
DOI: 10.3389/fpls.2017.01058

[…] hybrids. the economic costs and energy-use of pelleting commercial mxg was obtained from commercial pelleting mills of differing sizes [e.g., la meccanica clm200, 15 kw, italy, pellet mill in condex ltd. (lancaster, united kingdom)]., using standard united kingdom costs of truck transportation and normalized fuel consumption for the types of vehicle used (), the ghg and economic costs […]

PMCID: 4488318
PMID: 26125563
DOI: 10.1371/journal.pgen.1005347

[…] determined by pcr using tail dna. genotyping dnm1 ftfl (fitful) was done as previously []. the dnm1 tm2.1pdc/j allele was pcr amplified with specific primers (condf, 5’cagctgggtataatgaggcctcatc3’; condr, 5’gcatgggtgcac tcacatacacaa3’). presence of cre in the various strains was determined by pcr amplification with generic cre primers (oimr1084, 5’gcggtc tggcagtaaaaacta c3’; oimr1085, […]

PMCID: 4774829
PMID: 27047083
DOI: 10.14202/vetworld.2015.257-272

[…] those involved in the meat industry on the measures needed for a safer pork product. this concept, internationally promoted through trade agreements and regulations, is the building block of condex alimentarious [] inspiring to regulate the global food trade. globalized food trade regulations, sounding sensible for the safety of consumers, could be the end of national food security […]

PMCID: 3097714
PMID: 21610989
DOI: 10.2349/biij.5.4.e21

[…] nasal spine (pns), basion (ba), left orbitale (orl), and right orbitale (orr), mandible landmarks including left gonion (gol), right gonion (gor), left condyle head (condl), right condyle head (condr), center of left condyle (ccl), center of right condyle (ccr), subspinal (b), pogonion (pog), menton (me), and gnathion (gn), dentition landmarks including upper left incisor tip (a1l), upper […]


To access a full list of publications, you will need to upgrade to our premium service.

CONDEX institution(s)
Department of Computer Science, Columbia University, NY, USA; NYU Cancer Institute New York, University School of Medicine, NY, USA; Department of Computer Science, Columbia University New York, NY, USA
CONDEX funding source(s)
Supported by NSF IS 0845677, NSF IGERT 0333389, NSF CCF 0829882 and NIH U54 CA121852.

CONDEX reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review CONDEX