CONDEX statistics

info info

Citations per year

Number of citations per year for the bioinformatics software tool CONDEX
info

Tool usage distribution map

This map represents all the scientific publications referring to CONDEX per scientific context
info info

Associated diseases

info

Popular tool citations

chevron_left CNV detection chevron_right
Want to access the full stats & trends on this tool?

CONDEX specifications

Information


Unique identifier OMICS_05442
Name CONDEX
Alternative name condr
Software type Application/Script
Interface Command line interface
Restrictions to use None
Operating system Mac OS
Programming languages Java
License GNU General Public License version 3.0, GNU General Public License version 2.0
Computer skills Advanced
Stability Stable
Maintained Yes
Wikipedia https://code.google.com/archive/p/condr/wikis/RunningCONDEX.wiki

Download


download.png

Versioning


No version available

Documentation


Maintainers


  • person_outline Itsik Pe'er
  • person_outline Arthi Ramachandran
  • person_outline Mariann Micsinai

Additional information


https://code.google.com/archive/p/condr/wikis/ConversionfromPileup.wiki

Publication for CONDEX

CONDEX citations

 (4)
library_books

Economic and Environmental Assessment of Seed and Rhizome Propagated Miscanthus in the UK

2017
Front Plant Sci
PMCID: 5491852
PMID: 28713395
DOI: 10.3389/fpls.2017.01058

[…] between hybrids. The economic costs and energy-use of pelleting commercial Mxg was obtained from commercial pelleting mills of differing sizes [e.g., La Meccanica CLM200, 15 kW, Italy, Pellet Mill in Condex Ltd. (Lancaster, United Kingdom)]. […]

library_books

Independent Neuronal Origin of Seizures and Behavioral Comorbidities in an Animal Model of a Severe Childhood Genetic Epileptic Encephalopathy

2015
PLoS Genet
PMCID: 4488318
PMID: 26125563
DOI: 10.1371/journal.pgen.1005347

[…] re determined by PCR using tail DNA. Genotyping Dnm1 Ftfl (fitful) was done as previously []. The Dnm1 tm2.1Pdc/J allele was PCR amplified with specific primers (condF, 5’CAGCTGGGTATAATGAGGCCTCATC3’; condR, 5’GCATGGGTGCAC TCACATACACAA3’). Presence of cre in the various strains was determined by PCR amplification with generic cre primers (oIMR1084, 5’GCGGTC TGGCAGTAAAAACTA C3’; oIMR1085, 5’GTGAAACA […]

library_books

The commercial impact of pig Salmonella spp. infections in border free markets during an economic recession

2015
PMCID: 4774829
PMID: 27047083
DOI: 10.14202/vetworld.2015.257-272

[…] ducating those involved in the meat industry on the measures needed for a safer pork product. This concept, internationally promoted through trade agreements and regulations, is the building block of Condex Alimentarious [] inspiring to regulate the global food trade. Globalized food trade regulations, sounding sensible for the safety of consumers, could be the end of national food security if sma […]

library_books

3D vs. 2D cephalometric analysis comparisons with repeated measurements from 20 Thai males and 20 Thai females

2009
PMCID: 3097714
PMID: 21610989
DOI: 10.2349/biij.5.4.e21

[…] sterior Nasal Spine (PNS), Basion (Ba), Left Orbitale (OrL), and Right Orbitale (OrR)Mandible landmarks including Left Gonion (GoL), Right Gonion (GoR), Left Condyle Head (CondL), Right Condyle Head (CondR), Center of Left Condyle (CcL), Center of Right Condyle (CcR), Subspinal (B), Pogonion (Pog), Menton (Me), and Gnathion (Gn)Dentition Landmarks including Upper left incisor tip (A1L), Upper righ […]


Want to access the full list of citations?
CONDEX institution(s)
Department of Computer Science, Columbia University, NY, USA; NYU Cancer Institute New York, University School of Medicine, NY, USA; Department of Computer Science, Columbia University New York, NY, USA
CONDEX funding source(s)
Supported by NSF IS 0845677, NSF IGERT 0333389, NSF CCF 0829882 and NIH U54 CA121852.

CONDEX reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review CONDEX