CORNET statistics

To access cutting-edge analytics on consensus tools, life science contexts and associated fields, you will need to subscribe to our premium service.

Subscribe
info

Citations per year

Citations chart
info

Popular tool citations

chevron_left Protein-protein interaction prediction Gene co-expression prediction chevron_right
Popular tools chart
info

Tool usage distribution map

Tool usage distribution map
info

Associated diseases

Associated diseases

CORNET specifications

Information


Unique identifier OMICS_02875
Name CORNET
Alternative name CORrelation NETworks
Interface Web user interface
Restrictions to use None
Computer skills Basic
Stability Stable
Maintained Yes

Taxon


  • Plants and Fungi
    • Arabidopsis thaliana

Maintainer


  • person_outline Stefanie De Bodt <>

Publications for CORrelation NETworks

CORNET in publications

 (3)
PMCID: 4983113
PMID: 27521602
DOI: 10.1093/jxb/erw281

[…] and ccaccgtcgttaaccgtagt). all qrt-pcr experiments were performed in three biological replicates (unless otherwise specified) and 2–3 technical repeats, and the data presented represent means ±se., cornet analyses were done using standard settings in the tf tool on https://bioinformatics.psb.ugent.be/cornet/versions/cornet3.0/main/tf (, ; ). we used signalp 4.1 () with standard settings […]

PMCID: 4664945
PMID: 26620795
DOI: 10.1038/srep17617

[…] design sub-network contains information about differentially expressed genes when comparing wild-type plants to transgenic plants, and was obtained from the “genetic modification data set” of cornet, a publicly available database of gene associations in plants. the ppi sub-network was also obtained from cornet, and consists of both predicted as well as experimentally identified […]

PMCID: 3607608
PMID: 23536844
DOI: 10.1371/journal.pone.0058987

[…] many signature transcription factors known for their involvement in stress responses. a co-expression analysis based on a compendium of 69 ath1 biotic stress experiments, generated using the cornet tool, showed that many of these tfs have been found to be strongly co-expressed during various biotic stress experiments. from the 66-gene supernode cluster in the common group, […]


To access a full list of publications, you will need to upgrade to our premium service.

CORNET institution(s)
Department of Plant Systems Biology, Flanders Institute for Biotechnology, Ghent University, Ghent, Belgium; Department of Plant Biotechnology and Bioinformatics, Ghent University, Ghent, Belgium

CORNET reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review CORNET