CS-BLAST specifications

Information


Unique identifier OMICS_05170
Name CS-BLAST
Software type Package/Module
Interface Command line interface
Restrictions to use None
Operating system Unix/Linux
Computer skills Advanced
Stability No
Maintained No

Versioning


Add your version

Maintainer


This tool is not available anymore.

Information


Unique identifier OMICS_05170
Name CS-BLAST
Interface Web user interface
Restrictions to use None
Computer skills Basic
Stability No
Maintained No

Maintainer


This tool is not available anymore.

Publication for CS-BLAST

CS-BLAST in publications

 (20)
PMCID: 5739296
PMID: 29074568
DOI: 10.1091/mbc.E17-06-0400

[…] reverse primer 5′ gaatttgttcccccacagcg 3′, the conservation at each of the 46 threonine residues in villin was analyzed using the conseq () server. homologues were retrieved from uniref90 using the cs-blast algorithm with three iterations, an e-value cutoff of 0.0001, and a minimum sequence identity of 25%. sequences were then clustered at 90% sequence identity to remove any redundancy […]

PMCID: 5728490
PMID: 29236696
DOI: 10.1371/journal.pbio.2002039

[…] pho84 homologs was established with consurf []. starting from the pho84 protein sequence (sgd) as input, multiple sequence alignment was built using mafft. the homologs were collected from uniref90. cs-blast was used for the homolog search algorithm, with search parameters of csi-blast e-value of 0.0001, a maximal id of 95%, and a minimal id of 35%, and 3 iterations of csi-blast. csi-blast […]

PMCID: 5696648
PMID: 28826208
DOI: 10.1021/acssynbio.7b00108

[…] responses to probe other aspects of bacterial adaptation, survival, and evolution., a comprehensive database of lexa homologues was generated using the consurf server database, which utilizes cs-blast of the swiss-prot protein databank to calculate sequence homology and conservation of protein structures. lexa homologues were aligned and percent identity calculated using jalview sequence […]

PMCID: 5384802
PMID: 28435869
DOI: 10.1126/sciadv.1600663

[…] levels of the recombinant pka-c were probed by monoclonal antibodies from bd biosciences., the sequence conservation was plotted onto the protein structure using consurf-db (, ). initially, a cs-blast () search against the swiss-prot database was performed to obtain at least 50 unique hits. the list of collected homologs was subsequently filtered by coverage (minimum of 80%) and sequence […]

PMCID: 5274646
PMID: 28083762
DOI: 10.1007/s10969-016-9210-4

[…] sequences, last with m = 105 achieves better homology detection performance than blastp, and completes the search 20 times faster. compared to the most sensitive existing methods being used today, cs-blast and ssearch, last with miqs and m = 106 shows comparable homology detection performance at 2.0 and 3.9 times greater speed, respectively. results demonstrate that miqs-powered last […]


To access a full list of publications, you will need to upgrade to our premium service.

CS-BLAST institution(s)
Gene Center Munich and Department of Biochemistry, Ludwig-Maximilians-Universtät München, Munich, Germany

CS-BLAST reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review CS-BLAST