Cucumber Genome DataBase statistics

Tool stats & trends

Looking to identify usage trends or leading experts?

Protocols

Cucumber Genome DataBase specifications

Information


Unique identifier OMICS_29441
Name Cucumber Genome DataBase
Restrictions to use None
Community driven No
Data access File download, Browse
User data submission Not allowed
Maintained No

Maintainers


This tool is not available anymore.

Publications for Cucumber Genome DataBase

Cucumber Genome DataBase citations

 (18)
library_books

Expression and functional analysis of the Propamocarb related gene CsDIR16 in cucumbers

2018
BMC Plant Biol
PMCID: 5774166
PMID: 29347906
DOI: 10.1186/s12870-018-1236-2

[…] f CsDIR16 were cloned from cucumber fruits of ‘D0351’ and ‘D9320’ by reverse transcription-PCR (RT-PCR) (Fig. ). Then the sequence of CsDIR16 was confirmed by repeated sequencing. Comparison with the cucumber genome database (http://www.icugi.org/), the sequences of CsDIR16 cloned from cucumber fruits ‘D9320’ showed no difference. However, a A-to-G mutation at position 556 was found in the sequenc […]

library_books

Expression and functional analysis of the transcription factor encoding Gene CsERF004 in cucumber during Pseudoperonospora cubensis and Corynespora cassiicola infection

2017
BMC Plant Biol
PMCID: 5460474
PMID: 28583084
DOI: 10.1186/s12870-017-1049-8

[…] aw reads) were filtered with the FASTQ_Quality_Filter tool from the FASTX-toolkit. The filtered data were used for further analysis. After preprocessing the RNA-Seq data, the reads were mapped to the cucumber genome database (http://cmb.bnu.edu.cn/Cucumis_sativus_v20/) []. Differentially expressed genes were identified based on a p value ≤0.01 and | log2 ratio ≥ 1 |. […]

library_books

Cucumber (Cucumis sativus L.) Nitric Oxide Synthase Associated Gene1 (CsNOA1) Plays a Role in Chilling Stress

2016
Front Plant Sci
PMCID: 5104743
PMID: 27891134
DOI: 10.3389/fpls.2016.01652

[…] Basic Local Alignment Search Tool (BLAST) analysis of the Cucumber Genome Database (Huang et al., ) revealed a single NOA1-like gene, named CsNOA1 (Csa5M168870). CsNOA1 has 12 exons and 11 introns, which is different to the A. thaliana homolog, AtNOA1, which […]

library_books

Leaf Volatile Compounds and Associated Gene Expression during Short Term Nitrogen Deficient Treatments in Cucumis Seedlings

2016
Int J Mol Sci
PMCID: 5133771
PMID: 27827841
DOI: 10.3390/ijms17111713

[…] using the M-MLV reverse transcriptase (Promega, Madison, WI, USA). The specific primers of 23 CsLOX genes were synthesized by previous study []. Three cucumber HPL gene sequences were downloaded from Cucumber Genome DataBase [], the specific primers were designed using DNAMAN 6.0 (Lynnon Biosoft, San Ramon, CA, USA) for RT-PCR and qPCR (CsHPL1-F: TACCTTCATCTATTTCCCCC, CsHPL1-R: GAAGAACTTATCGGGTCCT […]

call_split

The Infection of Cucumber (Cucumis sativus L.) Roots by Meloidogyne incognita Alters the Expression of Actin Depolymerizing Factor (ADF) Genes, Particularly in Association with Giant Cell Formation

2016
Front Plant Sci
PMCID: 5025442
PMID: 27695469
DOI: 10.3389/fpls.2016.01393
call_split See protocol

[…] us study (Ruzicka et al., ). To assess the corresponding cucumber orthologs, a basic local alignment search tool (BLAST) was performed for each one of the A.thaliana ADF protein sequences against the Cucumber Genome Database (http://cucumber.genomics.org.cn/page/cucumber/index.jsp). Those with the highest amino acid percentage identity were selected. Cucumber ADFs were named according to the annot […]

library_books

Genome wide characterization of simple sequence repeats in watermelon genome and their application in comparative mapping and genetic diversity analysis

2016
BMC Genomics
PMCID: 4974753
PMID: 27495254
DOI: 10.1186/s12864-016-2870-4

[…] e SSR primer developed from watermelon genome assembly were used to BLAST search in cucumber Gy14 [] and melon DHL92 genome assembly [] which were downloaded from http://wenglab.horticulture.wisc.edu/cucumber-genome-database/ and https://melonomics.net, respectively. This was performed with a custom Perl script that used the NCBI BLASTN program as a search engine with expect value of 10 and filter […]

Citations

Looking to check out a full list of citations?

Cucumber Genome DataBase institution(s)
Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences, Sino-Dutch Joint Lab of Horticultural Genomics, Opening Lab of Genetic Improvement of Agricultural Crops of Ministry of Agriculture, Beijing, China; National Maize Improvement Center of China, Key Laboratory of Crop Genetic Improvement and Genome of Ministry of Agriculture, Beijing Key Laboratory of Crop Genetic Improvement, China Agricultural University, Beijing, China; USDA, ARS, Vegetable Crops Research Unit, Department of Horticulture, University of Wisconsin, Madison, WI, USA
Cucumber Genome DataBase funding source(s)
Supported by Chinese Mininstry of Agriculture (948 Program: 2008-Z42), Ministry of Science and Technology (2006DFA32140), and National Natural Science Foundation (30871707) and by the Program for New Century Excellent Talents in University (NCET-07-0811).

Cucumber Genome DataBase reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review Cucumber Genome DataBase