cutadapt protocols

View cutadapt computational protocol

cutadapt statistics

To access cutting-edge analytics on consensus tools, life science contexts and associated fields, you will need to subscribe to our premium service.

Subscribe
info

Citations per year

Citations chart
info

Popular tool citations

chevron_left Adapter trimming Demultiplexing chevron_right
Popular tools chart
info

Tool usage distribution map

Tool usage distribution map
info

Associated diseases

Associated diseases

cutadapt specifications

Information


Unique identifier OMICS_01086
Name cutadapt
Software type Application/Script
Interface Command line interface
Restrictions to use None
Operating system Unix/Linux
License MIT License
Computer skills Advanced
Stability Stable
Maintained Yes

Download


Versioning


Add your version

Publication for cutadapt

cutadapt in pipelines

 (491)
2018
PMCID: 5754489
PMID: 29301880
DOI: 10.1128/genomeA.01399-17

[…] prep library kit (kapa biosystems) and sequenced on an illumina miseq platform using a 250-bp paired-end format, resulting in a total of 5,320,190 reads. the raw sequences were preprocessed using cutadapt version 1.14 to trim adaptors () and using prinseq version 0.20.4 to perform quality filtering (). initial genome assembly was performed with the spades version 3.10.0 genome assembler […]

2018
PMCID: 5758801
PMID: 29311560
DOI: 10.1038/s41598-017-18308-8

[…] sequences (index 1–9). sequencing was performed on a hiseq. 2000/2500 (illumina)., for preprocessing, we removed adapter sequences and low-quality ends from clip-seq and rna- seq reads by using cutadapt version 1.10 with -m 17–match-read-wildcards -o 10 -e 0.1 -q 30,30 -g aatgatacggcgaccaccgagatctacacgttcagagttctacagtccgacgatc –a tggaattctcgggtgccaaggaactccagtcac options. artifact reads […]

2018
PMCID: 5759179
PMID: 29354114
DOI: 10.3389/fmicb.2017.02630

[…] concerned the accessions ranging from srr1542919 to srr1542936 (table ). reads in the associated measurements were first cleaned by removing adapters, low quality regions, or complete reads using cutadapt (martin, ) and sickle (joshi and fass, ). the quality score cutoff was set to 30 in respect to quality trimming, and the minimum length of read threshold was set to 30. following cleaning […]

2018
PMCID: 5761873
PMID: 29320577
DOI: 10.1371/journal.pone.0190485

[…] then subjected to next-generation sequencing to generate small rna reads. the quality of generated reads was assessed using fastqc, a quality control tool., the reads after removal of 3/ adapters by cutadapt were aligned to the human reference genome and transcriptomes using bowtie, an efficient and widely used genome-scale alignment tool []. the uniquely mapped reads with no more than one […]

2018
PMCID: 5774894
PMID: 29142125
DOI: 10.1128/JVI.01246-17

[…] (illumina inc., ca, usa) at the centre for genomic research (cgr), university of liverpool, united kingdom., illumina adapter sequences were trimmed from the raw fastq sequence data by using cutadapt v1.2.1 () and sickle v1.2 software (). complete consensus nucleotide sequences were generated by mapping trimmed illumina sequence reads to various complete nucleotide sequences of prototype […]


To access a full list of citations, you will need to upgrade to our premium service.

cutadapt in publications

 (1489)
PMCID: 5964442
DOI: 10.1128/mSystems.00025-18

[…] programs for data analysis were run on the bioinformatics cluster of cgr (university of liverpool) in a debian 5 or 7 environment., raw fastq files were trimmed to remove illumina adapters using cutadapt version 1.2.1 with option -o 3 () and sickle version 1.200 with a minimum quality score of 20 (). further quality control was performed with prinseq-lite () with the following parameters: […]

PMCID: 5952419
PMID: 29764370
DOI: 10.1186/s12879-018-3127-4

[…] hiseq2500. on average 49–50 million basepair (bp) reads were produced per sample. quality check of reads was performed with the software fastqc. low quality reads and adapters were trimmed with cutadapt []. trimmed reads were mapped to the human genome grch38/hg19 with star [], and the expression level for each gene was counted with htseq [] according to gene annotations from ensembl. […]

PMCID: 5951918
PMID: 29760424
DOI: 10.1038/s41467-018-04215-7

[…] genome sequences generated (as described earlier)., allele-specific alignment of single cell mrna libraries: fastq files of the sequenced transcripts were run through fastqc tool (version 0.10.1), cutadapt tool (version 1.2) and trim galore (version 0.4.1) to remove transposase sequence remainders (ctgtctcttatacac). files then were aligned against the generated transcriptome reference using […]

PMCID: 5945586
PMID: 29760939
DOI: 10.1038/s41439-018-0004-z

[…] in the 101-bp paired-end mode. sequence reads were mapped and aligned to the reference genome sequence hs37d5 using our pipeline including grepwalk (http://epigenetics.nrichd.ncchd.go.jp/grepwalk/), cutadapt-1.7.1 (https://cutadapt.readthedocs.io/en/stable/), bwa mem (http://bio-bwa.sourceforge.net/), samtools 1.3 (http://samtools.sourceforge.net/), picard 2.1.1 (http://picard.sourceforge.net/), […]

PMCID: 5943456
PMID: 29743479
DOI: 10.1038/s41467-018-04283-9

[…] were mapped to the human reference genome hg19 with the star (version 2.5.0b) aligner. low-quality reads (mapping quality <20) as well as known adapter contaminations were filtered out using cutadapt (version 1.10.0). read counting was performed using bioconductor packages rsubread and differential expression analysis with edger,. the conditions were contrasted against the growing […]


To access a full list of publications, you will need to upgrade to our premium service.

cutadapt institution(s)
Department of Computer Science, TU Dortmund, Germany
cutadapt funding source(s)
Supported by Mercator Research Center Ruhr, Germany, grant Pr-2010-0016.

cutadapt review

star_border star_border star_border star_border star_border
star star star star star
Anonymous user #60's avatar image No country

Anonymous user #60

star_border star_border star_border star_border star_border
star star star star star
Desktop
Very useful to remove adapters in read 3'end, allowing for mismatches due to sequencing errors. Con: python dependencies