Computational protocol: Slaughterhouse Pigs Are a Major Reservoir of Streptococcus suis Serotype 2 Capable of Causing Human Infection in Southern Vietnam

Similar protocols

Protocol publication

[…] All non-duplicate S. suis serotype 2 strains were characterized by multi locus sequence typing (MLST) and pulse field gel electrophoresis (PFGE) as described previously , . The multi locus sequence type assignment was based on the sequence of the alleles at each locus of 7 housekeeping genes included in the MLST scheme, using the MLST database . Primer sequences used were as described and published on the MLST website (www.mlst.net), except for the recA and mutS alleles for which adjusted primers were designed with the following sequences; ssrecA-f: ATAGCCACGTTGGTTTGCAG, ssrecA-r: CATAATGAACACGTATCTTGCGG; ssmutS-f GAGCAGATGGAAGATCCTAAGC, ssmutS-r ACAAACTACCATGCTTCTTGCC. MLST results were analyzed using eBURST (www.mlst.net) .PFGE with SmaI digestion was performed as described elsewhere and the images of gels were analysed using Bionumerics (Applied Maths, Belgium). Six strains, each representing one of the six predominant PFGE types which were identified in S. suis serotype 2 strains isolated from human patients with meningitis in southern and northern Vietnam , , were included in the PFGE analysis to facilitate comparison of strains isolated from humans and pigs. […]

Pipeline specifications

Software tools BURST, BioNumerics
Databases MLST.net
Application WGS analysis
Organisms Streptococcus suis, Sus scrofa, Homo sapiens, Bacteria
Diseases Infection, Meningitis, Zoonoses, Meningitis, Bacterial