Dataset features

Specifications


Dataset type: Other
Number of samples: 4
Release date: Oct 31 2017
Last update date: Nov 21 2018
Access: Public
Dataset link 5C analysis of the Epidermal Differentiation Complex locus reveals distinct chromatin interaction networks between gene-rich and gene-poor TADs in skin epithelial cells

Experimental Protocol


Two independent 5C libraries were constructed for freshly plated epidermal keratinocytes and primary thymocytes. 5C probes were designed at HindIII restriction sites using the my5Csuite primer design tools http://my5C.umassmed.eduAn alternating scheme was pursued in which reverse and forward probes were designed against every other fragment. Probes were excluded if unique mapping could not be achieved for fragments spanning highly repetitive sequences. Probe setting were as follows: U-BLAST, 3; S-BLAST, 50; MER, 800; MIN, FRAGSIZE, 100; MAX FRAGSIZE, 50000; OPT_TM, 65: and OPT_PSIZE, 40. The universal T7 sequence was tethered to all forward primers (TAATACGACTCACTATAGCC) and the reverse complement to the universal T3 sequence was tethered to all reverse probes (TATTAACCCTCACTAAAGGGA). In total, 381 forward probes and 382 reverse probes were designed, spanning 5.3 Mb EDC containing locus.

Repositories


GEO

GSE102519

ENA

SRP115233

BioProject

PRJNA397924

Download


Dataset Statistics

info

Citations per year

Dataset publication