Computational protocol: In-situ Effects of Eutrophication and Overfishing on Physiology and Bacterial Diversity of the Red Sea Coral Acropora hemprichii

Similar protocols

Protocol publication

[…] Incubation measurements were performed as follows: coral fingers were transferred to 1 L incubation glass jars in three opaque polyethylene (PE)-boxes filled with reef water (∼ 70 L) to keep samples at constant ambient temperatures during incubations. One jar per PE-box, filled only with reef water, served as a control. All PE-boxes were placed in the shade to avoid warming of the water. Dark incubation started after acclimatizing the samples for 1–2 hours in the dark PE-boxes. Initial O2 concentrations were measured with an O2 probe (HQ40d, Hach, Loveland, CO) inside each box after evenly distributing the water, with open incubation jars. The jars were then sealed and incubated over a period of 90–100 min before O2 concentrations in each jar were measured as described above. During incubations the boxes were carefully moved every 5 minutes to cause stirring of water inside the jars. Onset HOBO temperature loggers (Onset Computer Corporation, Pocasset, MA) in each box assured that water temperature during incubation remained constant (temperature differences between incubation jars and in-situ temperatures measured at PVC frames ranged between 0.5 and 1.6°C). All samples were subsequently stored on ice until further processing. Net O2 consumption was calculated subtracting end concentrations from the start concentrations. Normalization of data to µg O2 cm−2 h−1 was carried out by measuring the coral finger surface area using a cylinder as approximation according to the “simple geometry” model described by Naumann et al. and by taking into account the exact incubation times. To investigate zooxanthellae abundance, chlorophyll a concentration, and δ15N isotopic signatures, tissue of each coral finger was washed with filtered sea water (FSW) before tissue was removed from the skeleton by air-blasting, collected in FSW, and homogenized using an Ultra-Turrax (T 18 basic, IKA, Staufen, Germany; 30 s at 3,500 rpm). Zooxanthellae abundance was counted using an Improved Neubauer hemocytometer (Hausser Scientific, Horsham, PA). Cell numbers were counted in 6 grid squares à 4 µm3 with 6 counts per sample (average count: 29 cells per grid square). To determine isotopic signatures of coral tissue and zooxanthellae, a modified version of was used. The homogenate of coral tissue and zooxanthellae was centrifuged for 5 min in a tabletop centrifuge at 1,500 rpm to separate coral tissue and zooxanthellae. Recorded data were normalized to zooxanthellae cm−2 with surface area (see method described above). Homogenized coral tissue was first filtered on a GF/F filter and washed with MilliQ water to remove remaining salt. Subsequently, the filters were dried for 2–4 d at 40°C until constant weight and δ15N signatures were determined relative to atmospheric nitrogen in an isotope ratio mass spectrometer (Finnigan Corp., San Jose, CA). Isolated zooxanthellae were freeze-dried and directly measured with the mass spectrometer. For Symbiodinium-typing, DNA was extracted using the DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. The ITS2 rDNA region was amplified with the primer pair ITSintfor2 and ITS2CLAMP using PCR conditions described in . Amplified fragments were separated on 8% polyacrylamide gels, following , and using a CIPHER DGGE KIT (CBS Scientific Company, Del Mar, CA). Gels were run at 150 V for 15 h and stained for 20 min with 1x SYBR Green (Invitrogen, Carlsbad, CA) and visualized on a Dark Reader Transilluminator (Clare Chemical Research, Dolores, CO). Symbiodinium types were determined by DGGE fingerprint profiles and sequencing. For sequencing, prominent band(s) were excised from the DGGE gel and re-amplified as described in . Re-amplified products were purified following manufacturer’s instructions for Illustra ExoStar (GE Life Sciences, Piscataway, NJ). Samples were sent for bi-directional Sanger sequencing to the KAUST BioScience Core Laboratory (Thuwal, Saudi Arabia). Sequences were trimmed for quality in CodonCode Aligner (CodonCode Corporation, Centerville, MA). Forward and reverse sequences were assembled into contigs and aligned using ClustalW. Each contig was BLASTed against a local database of Symbiodinium ITS2 sequences. Coral respiration rates, chlorophyll a, zooxanthellae abundance, and δ15N isotopic signatures of corals and zooxanthellae were analyzed with Sigmaplot 12 (Systat Software, Point Richmond, CA) by two-way ANOVA. To meet parametric assumptions, δ15N coral data for colony-time factorial analysis were exponential transformed, and chlorophyll a and respiration data for genotype-time factorial analysis were square transformed. [...] DNA from flash frozen coral fragments and water filters was extracted using the Qiagen DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instruction. Coral tissue was separated from skeleton using high-pressure air and extraction buffer, while filters were bead-beaten with extraction buffer for 1 minute. For water samples, DNA of all filters from week 1 and of all filters from week 16 were pooled resulting in two water samples that represent a comprehensive reef water microbial composition from week 1 and week 16. For PCR amplification of the 16S rRNA gene, we used the primers 784F and 1061R that amplify E. coli position 781 to 1,060 . The primer sequences were 5′CTATGCGCCTTGCCAGCCCGCTCAGtaAGGATTAGATACCCTGGTA3′ (784F) and 5′CGTATCGCCTCCCTCGCGCCATCAG(N)8ctCRRCACGAGCTGACGAC3′ (1061R). Primers include 454 LibA library adapters (underlined), a barcode (shown as N) , and a two base pair linker sequence to avoid barcode influence on the amplification (lowercase). PCRs were run in 30 µL triplicates per sample with Qiagen Multiplex PCR Kit (Qiagen, Hilden, Germany) and 30 ng/µL of input DNA using the following protocol: 15 min at 95°C, followed by 27 cycles of 95°C for 40 s, 55°C for 40 s, 72°C for 40 s, and a final extension cycle of 10 min at 72°C. PCR products were run on an 1% agarose gel to visualize successful amplification. Sample triplicates were pooled and then purified using PALL multi-well filter plates (Pall Corporation, Port Washington, NY) and a Millipore multiscreen HTS vacuum manifold (Millipore Corporation, Billerica, MA). DNA concentrations were measured using a Qubit 2.0 (Invitrogen, Carlsbad, USA) and adjusted to 30 ng/µL before subsequent pooling. The pooled sample ran on a 1% agarose gel to remove excess primers. DNA was subsequently isolated from the gel using the Qiagen MinElute Gel Extraction Kit (Qiagen, Hilden, Germany) according to manufacturer’s instructions. PCR products were sequenced using Titanium FLX chemistry on a quarter of a picotiter plate. Raw pyrosequencing reads were processed using the open source software mothur v.1.28.0 for error correction, taxonomical classification using the greengenes database , and calculation of alpha-diversity and beta-diversity indices. More specifically, sequencing resulted in a total of 166,741 reads with a median length of 303 bp. The reads were split according to barcodes, error corrected, and quality trimmed using PyroNoise as implemented in mothur, and subsequently aligned to the SILVA database alignment v102 . We removed any sequences that did not cover positions 26,988 to 34,113 (variable regions 5 and 6 of the 16S rRNA gene). To reduce sequencing noise, a pre-clustering step as implemented in mothur (maximal two base pairs difference) was performed . Further reads were removed after a check for chimeric sequences using UCHIME as implemented in mothur and/or their identification as chloroplast or mitochondrial contamination. The resulting dataset of 112,414 sequence reads was used for all analyses. The mothur “classify.seqs” function was used to classify all sequences against the 2011 Green Genes database as provided on the mothur webpage. For classification a bootstrap cutoff of 60% was used. For the UniFrac analysis, the sequences were subsampled to the lowest number of sequences in any group (3,283 sequences, week 1, sample C, treatment CA). The Principal Coordinate (PCoA) and ANOSIM analysis were also performed in mothur, the plot was generated using the ggplot2 package in R . All sequences are available in the NCBI Sequence Read Archive (http://www.ncbi.nlm.nih.gov/sra) under accession number SRA062645. Mann-Whitney U test was conducted in Sigmaplot 12 (Systat Software, Point Richmond, CA). To determine distinct Operational Taxonomic Units (OTUs) that were significantly associated with A. hemprichii under treatments of overfishing, eutrophication, or both, we used the statistical package indicspecies . We chose a conservative approach considering only OTUs that were highly significantly (P<0.01) associated with one or several sample groups. […]

Pipeline specifications