Computational protocol: Mechanism of DNA substrate recognition by the mammalian DNA repair enzyme, Polynucleotide Kinase

Similar protocols

Protocol publication

[…] Solution scattering data were collected at the SIBYLS beamline BL 12.3.1 ALS Berkeley, California, and processed as previously described (). Tunable wavelength (λ) and the sample-to-detector distances were set to 1.0–1.5 Å and 1.5 m, respectively, resulting in scattering vectors (q) ranging from 0.008 Å−1 to 0.31 Å−1 for q = 4πsin(θ)/λ, where 2θ is the scattering angle. SAXS data at short and long time exposures (6 s, 60 s) were merged to define the entire scattering profile. Different protein concentrations were tested for aggregation and examined by Guinier plots (). The radius of gyration (RG) was derived by the Guinier approximation I(q) = I(0) exp(−q2RG2/3) with the limits qRG < 1.3. The curves measured for different protein concentrations (1.9–7.7 mg/ml) displayed a concentration dependence arising from interparticle interaction and interference-free scattering profiles were estimated by extrapolating the measured scattering curves to infinite dilution. Observed molecular weight for the PNK sample was estimated by calculating the normalized scattering intensity at zero angle [q = 0; I(0)] relative to four standard proteins: lysozyme, xylanase, BSA and glucose isomerase (). GNOM () was used to calculate the pair-distance distribution functions, P(r), and define the maximum dimension of the macromolecule, Dmax.Scattering data were collected for free DNA substrates (H1 and H3, 33 μM each), for free proteins (mPNK 1.9–7 mg/ml and PK 1.9–7.7 mg/ml) and for protein:DNA complexes in 100 mM KCl, 33 mM Tris pH 7.5, 0.7 mM DTT, 0.7 mM MgSO4. The DNA sequences were TATGATACGCAGTATCATACCAAT (H1) and TATGATAC GGCGCCTGGGGGCACCCCAGGCGCCGTATCATACCAAT (H3) (single-stranded loops and 3′ tails are highlighted in bold). The relative amounts of protein and DNA used in preparation of complexes were determined by titration on a 10% native polyacrylamide gel at points where all the free DNA was shifted into the protein:DNA band. [...] The SAXS envelopes were reconstructed from the experimental data using DAMMIN (). Twenty bead models obtained for each SAXS experiment were averaged by DAMAVER () to construct the average model representing general structural features of each reconstruction. Bead models were converted to volumetric SITUS format with the pdb2vol kernel convolution utility (). To better define regions of the envelopes associated with the DNA, we calculated difference maps by first aligning the envelope obtained from the free protein with those obtained from the two complexes (PK/H1 or PK/H3). Subtraction of the aligned maps was carried out to define regions of difference density. [...] The EMAP docking approach was used to generate PK–substrate complex models and to rank these models based on their fit to the experimental data using CHARMM () (http://www.charmm.org/html/documentation/c34b1/emap.html). Both the protein and DNA substrates were represented as rigid domains with intact van der Waals and electrostatic properties and were moved as independent objects. The grid-threading Monte Carlo method was used to sample 1200 orientations of H1 over the PK surface, followed by an energy-based docking search. This strategy produced conformationally reasonable docked assemblies with a minimum of steric clashes. The theoretical scattering profile, RG and the corresponding fit to the experimental scattering curve were calculated using the program CRYSOL (). [...] Considering the flexibility of the FHA domain or the presence of uncomplexed PK in PK/DNA samples, the coexistence of different conformations that contribute to the experimental scattering curve was taken into account. Based on the ensemble optimization method described by Bernado et al. (), we developed an algorithm that searches for the minimal ensemble (MES) of the conformations from the pool of all generated conformations in previous MD simulations (). The multiconformational scattering I(q) from such a minimal ensemble was computed by averaging the individual scattering profiles from the conformers: where I1,2,3, … , N(q) were the scattering profiles from the single conformers and the momentum transfer.A genetic algorithm-based search was used to select an appropriate ensemble from a pool of all generated conformations. The scattering curves from all structures in the pool were pre-computed and the selection was performed using these curves. The final model achieved the best fit to the experimental curve Iexp(q) by minimizing the discrepancy χ2 between the experimental and calculated multi-conformational curve: where K was the number of experimental points, σ(q) were standard deviations and μ was a scaling factor ().Comparison of the structural properties of the selected models in the ensemble subset allowed us to distinguish the degree of flexibility of the experimental system. As shown in D, the spread of structural parameters RG, CαRMSD for the MES-derived ensembles relative to those determined for the entire pool, correlated strongly with the level of disorder. We observed large differences between structural parameters of the selected ensemble models for flexible/disordered systems like the FHA domain in mPNK. Figure 1. Figure 2. Figure 3. […]

Pipeline specifications

Software tools ATSAS, DAMMIN, Situs, CHARMM, CRYSOL, EOM
Databases EMAP
Applications Small-angle scattering, Protein structure analysis
Organisms Homo sapiens, Dipturus trachyderma