Computational protocol: Pause-melting misalignment: a novel model for the birth and motif indel of tandem repeats in the mitochondrial genome

Similar protocols

Protocol publication

[…] We used 20 individuals of P. cornutus, thirteen from Dongshan, East China Sea and seven from Qingdao, Yellow Sea. A portion of the epaxial musculature was excised from each fresh specimen, and immediately stored at −70°C. Total genomic DNA was extracted using an SQ Tissue DNA Kit (OMEGA, China) following the manufacturer’s protocol. Two primer pairs (L-DL: ACTCCCAAAGCCAGGATTCT, H-DL: GAGGGTGAGGTTTAACGGGGG; L-AP1: GCCTGTAGCTTTTTAGGTAT, H-AP2: AAGCATAACACTGAAGATG) were designed for amplification of P. cornutus control region sequences. The PCR was performed in a 25μl reaction volume containing 2.0 mM MgCl2, 0.4 mM dNTP, 0.5 μM of each primer, 1.0 U Taq polymerase (Takara, Dalian, China), 2.5 μl 10x Taq buffer, and approximately 50 ng DNA template. PCR cycling conditions included an initial denaturation at 95°C for 3 min, 35 cycles of a denaturation at 94°C for 45 s, an annealing step at 48°C for 45 s, and elongation at 72°C for 3 min with a final extension at 72°C for 5 min. The PCR products were detected in 1.0% agarose gels and purified using a Takara Agarose Gel DNA Purification Kit (Takara, China). Purified products were inserted into the PMD18-T vector (Takara, China), and then transformed into E. coli competent cells. The final cloned products were sequenced in both directions using the ABI 3730 genetic Analyzer. Primers used in sequencing were the same as those used for PCR, and new primers were designed for walking sequencing. The sequenced fragments were assembled using DAMBE v 5 [] and BioEdit v 7.0.1 []. [...] The sequences of 1726 vertebrate mt genomes were retrieved from the NCBI genome database in March, 2012 (http://www.ncbi.nlm.nih.gov/genome). Repeated sequences were identified using Tandem Repeats Finder v4.03 [] with the following parameters: match +2, mismatch −7, indel −7. Only those repeats whose scores exceeded 50 were reported. Looser or stricter parameters were also tested in the same software packages, but these resulted in more paradoxical repeats and the loss of some repeats from the dataset.The location of TRs in mt genomes from GenBank was manually checked, and TRs located in the CRs were classified by their location relative to the 3′ or 5′ end. Those TRs without a clear location in the CR were not used in the statistical analysis. Utilizing SPSS software, the distributions of motif lengths in the 3′ and 5′ ends and in protein coding genes were analyzed. […]

Pipeline specifications

Software tools DAMBE, BioEdit, TRF, SPSS
Applications Miscellaneous, Phylogenetics
Organisms Pleuronichthys cornutus
Diseases Eye Abnormalities