DNABind

[…] to the alba superfamily of dna/rna-binding domains (). the molecular function of duf4357 and duf4268 remains unknown. according to our sequence-based predictions of their dna-binding potential using dnabind server (), only duf4268 is likely (with 98% probability) to bind dna. apart from reases, group 3 contains bacterial putative extracellular nucleases containing transmembrane helices […]

[…] dr pip., to allow for a more detailed comparison of precision-recall curves, we focused on methods that give numerical scores rather than binary classification. we submitted our own set of dbps to dnabind and dnabinder. the prc is shown in . dr pip performance on the non-redundant dataset significantly exceeds the other methods., dr pip was designed to excel on proteins […]

[…] auc value of idbp with these predictors. as the auc scores for idna-prot, dna-prot, endna-prot, ndna-prot, and dbd-threader were unavailable, the comparisons were performed among dbppred, dnabinder, dnabind and idbp. the dbppred, dnabinder, dnabind produced the auc scores of 0.791, 0.607 and 0.694. our idbp yielded the highest auc score of 0.803, which was slightly better than dbppred.table 2, […]

[…] of psi‐blast with an e‐value of 0.0001. the models, along with comparator crystal structures of known function were submitted to the structure‐based nucleic acid binding prediction servers dnabind, and idbps. , b‐form double‐stranded (ds)dna (default sequence ccctgtggagccacaccctag and its complementary strand) was generated at the make‐na server. data‐driven docking on the haddock web […]

[…] assessed include bindn[], bindn+[], rnabindr[], rnabindrplus[], dbs-pred[], dbs-pssm[], kyg[], prbr[], pprint[], dnabindprot[], protedna[], displar[], dr_bind1[], aarna[], rbscore[], rbrdetector[], dnabind[], xypan[] and rnaprosite (lilab.ecust.edu.cn/nabind/), while the programs are predict_rbp[], prna[] and rbrident[]. previously reported prediction approaches have been summarized in . slow […]