DNABind statistics

To access cutting-edge analytics on consensus tools, life science contexts and associated fields, you will need to subscribe to our premium service.

Subscribe
info

Citations per year

Citations chart
info

Popular tool citations

chevron_left Protein-DNA interaction prediction chevron_right
Popular tools chart
info

Tool usage distribution map

Tool usage distribution map
info

Associated diseases

Associated diseases

DNABind specifications

Information


Unique identifier OMICS_07139
Name DNABind
Interface Web user interface
Restrictions to use None
Computer skills Basic
Stability Stable
Maintained Yes

Publication for DNABind

DNABind in publications

 (10)
PMCID: 5714182
PMID: 29040665
DOI: 10.1093/nar/gkx924

[…] to the alba superfamily of dna/rna-binding domains (). the molecular function of duf4357 and duf4268 remains unknown. according to our sequence-based predictions of their dna-binding potential using dnabind server (), only duf4268 is likely (with 98% probability) to bind dna. apart from reases, group 3 contains bacterial putative extracellular nucleases containing transmembrane helices […]

PMCID: 5121330
PMID: 27869118
DOI: 10.1038/ncomms13424

[…] dr pip., to allow for a more detailed comparison of precision-recall curves, we focused on methods that give numerical scores rather than binary classification. we submitted our own set of dbps to dnabind and dnabinder. the prc is shown in . dr pip performance on the non-redundant dataset significantly exceeds the other methods., dr pip was designed to excel on proteins […]

PMCID: 5002159
PMID: 27565741
DOI: 10.1186/s12859-016-1201-8

[…] auc value of idbp with these predictors. as the auc scores for idna-prot, dna-prot, endna-prot, ndna-prot, and dbd-threader were unavailable, the comparisons were performed among dbppred, dnabinder, dnabind and idbp. the dbppred, dnabinder, dnabind produced the auc scores of 0.791, 0.607 and 0.694. our idbp yielded the highest auc score of 0.803, which was slightly better than dbppred.table 2, […]

PMCID: 5031224
PMID: 27318187
DOI: 10.1002/prot.25088

[…] of psi‐blast with an e‐value of 0.0001. the models, along with comparator crystal structures of known function were submitted to the structure‐based nucleic acid binding prediction servers dnabind, and idbps. , b‐form double‐stranded (ds)dna (default sequence ccctgtggagccacaccctag and its complementary strand) was generated at the make‐na server. data‐driven docking on the haddock web […]

PMCID: 4683125
PMID: 26681179
DOI: 10.1371/journal.pcbi.1004639

[…] assessed include bindn[], bindn+[], rnabindr[], rnabindrplus[], dbs-pred[], dbs-pssm[], kyg[], prbr[], pprint[], dnabindprot[], protedna[], displar[], dr_bind1[], aarna[], rbscore[], rbrdetector[], dnabind[], xypan[] and rnaprosite (lilab.ecust.edu.cn/nabind/), while the programs are predict_rbp[], prna[] and rbrident[]. previously reported prediction approaches have been summarized in . slow […]


To access a full list of publications, you will need to upgrade to our premium service.

DNABind institution(s)
Department of Computer Science and Engineering, University of South Carolina, Columbia, SC, USA

DNABind reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review DNABind