Dr.Probe statistics

info info

Citations per year

info

Tool usage distribution map

info info

Associated diseases

info

Popular tool citations

chevron_left Image simulation chevron_right
Want to access the full stats & trends on this tool?

Dr.Probe specifications

Information


Unique identifier OMICS_30051
Name Dr.Probe
Alternative name Dr. Probe
Software type Application/Script
Interface Command line interface, Graphical user interface
Restrictions to use Academic or non-commercial use
Operating system Unix/Linux, Mac OS, Windows
Computer skills Advanced
Version 1.8.6
Stability Stable
Maintained Yes

Download


download.png

Versioning


No version available

Maintainer


  • person_outline Juri Barthel

Additional information


http://www.er-c.org/barthel/drprobe/drprobe-doc.html

Publication for Dr.Probe

Dr.Probe citations

 (13)
library_books

Real space analysis of diffusion behavior and activation energy of individual monatomic ions in a liquid

2017
Sci Adv
PMCID: 5731997
PMID: 29250598
DOI: 10.1126/sciadv.1701546

[…] ADF image simulation was performed using the multislice method () with Dr. Probe high-resolution (S)TEM image simulation software. The C2mimTFSI liquid structure with a thickness of 3 nm was prepared on the basis of the aforementioned structure determined by molecular dy […]

library_books

Sulfonated reduced graphene oxide catalyzed cyclization of hydrazides and carbon dioxide to 1,3,4 oxadiazoles under sonication

2017
Sci Rep
PMCID: 5498654
PMID: 28680037
DOI: 10.1038/s41598-017-04143-4

[…] F instrument (Japan) was used for the morphology studies and EDX spectra. For high resolution transmission electron microscope studies, HR-TEM, model JEM-2010, JEOL, Tokyo, Japan was used. 4mm CP/MAS DR probe solid state 13CNMR MAS resonance spin rate at 10 KHz was used. […]

library_books

Nanometre scale 3D defects in Cr2AlC thin films

2017
Sci Rep
PMCID: 5430507
PMID: 28428564
DOI: 10.1038/s41598-017-01196-3

[…] stants, as shown in Fig. . In addition, a simulation of the STEM-HAADF image was carried out using the Cr2AlC supercell with the multi-slice method, as shown in Fig. . An in-house developed software (Dr. Probe) was used for the STEM image simulation. In the simulation, partial spatial coherence was considered by subsequent convolution of the effective source profile, which was set with a Lorentz d […]

library_books

Chromosomal integration of HHV 6A during non productive viral infection

2017
Sci Rep
PMCID: 5428774
PMID: 28360414
DOI: 10.1038/s41598-017-00658-y

[…] re probe (Probe P4). HHV-6 viral DR specific probe was generated from a DR-PCR product (~3, 5 kb) amplified using 5′-AGGAACAGACAGACGGCCAC-3′ and 5′-CTCTGCGGGGATTCACGGAT-3′ primers. Similarly, the non-DR probe was generated using the following primers: 5′ATGAAATTATCCGGACTATACTGTG3′ and 5′GTTGGGAGTTAACATTTTGAAAGTG3′ that amplifies the HHV-6A IE2 ORF. […]

library_books

Electron efficiency measurements with the ATLAS detector using 2012 LHC proton–proton collision data

2017
PMCID: 5434979
PMID: 28579919
DOI: 10.1140/epjc/s10052-017-4756-2

[…] illing ET (probe) + ET (photon) > 30 GeV. Requirements are placed on the angular distance between the photon and the electron candidates to avoid double counting of objects: ΔR (tag–photon) > 0.4 and ΔR (probe–photon) > 0.2. The reason for the asymmetry between tag and probe electron requirements is an isolation requirement with a cone size of 0.4 which is applied to the tag electron as one of the […]

library_books

Surface reconstructions and related local properties of a BiFeO3 thin film

2017
Sci Rep
PMCID: 5244358
PMID: 28102296
DOI: 10.1038/srep39698

[…] 0 mrad for HAADF imaging. All high-resolution ABF/HAADF images shown in this work are shown as raw data without any post-filtering.Multislice ABF and HAADF STEM image simulations were performed using Dr. Probe software on the basis of atomic models relaxed by first-principles DFT calculations and using experimental imaging parameters. Considering the unique site occupation in the Bi75, Bi25 and O4 […]


Want to access the full list of citations?
Dr.Probe institution(s)
Central Facility for Electron Microscopy, RWTH Aachen University, Aachen, Germany; Ernst Ruska-Centre, Forschungszentrum Jülich GmbH, Jülich, Germany
Dr.Probe funding source(s)
Supported by the German Science Foundation (DFG) by grant MA 1280/40-1.

Dr.Probe reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review Dr.Probe