Computational protocol: Transcriptome analysis of secondary cell wall development in Medicago truncatula

Similar protocols

Protocol publication

[…] Stems of 7 weeks old M. truncatula plants (totally 10-11 internodes) were used for sampling. Internodes 2, 3, 5, 7 and 9 counting from the plant tip were collected. Total RNAs were extracted using tri-reagent according to the manufacturer’s protocol (Invitrogen). RNA was cleaned and concentrated using the RNeasy MinElute Cleanup kit (Qiagen, http://www.qiagen.com). Ten micrograms of purified RNA were used for microarray analysis. The microarray experiment included five internodes with three biological replicates, used 15 Affymetrix Genechips in total. Probe labeling, hybridization and scanning were conducted according to the manufacturer’s instructions (Affymetrix, http://www.affymetrix.com). The normalization of data was achieved by the robust multi-chip average (RMA) procedure []. The presence/absence call for each probe set was obtained from dCHIP []. Genes significantly differentially expressed between controls and mutants were selected using Associative Analysis []. The type-I family-wise error rate was reduced using a Bonferroni corrected P-value threshold of 0.05/n, where n represents the number of genes present on the chip. The false discovery rate was monitored and controlled by Q-value (false discovery rate), calculated using EDGE (extraction of differential gene expression; http://www.bioconductor.org/packages/release/bioc/html/edge.html) [, ]. Hierarchical clustering analysis was conducted with Spotfire DecisionSite 8.1 (Spotfire Inc., http://spotfire.tibco.com/). For clustering analysis, data from different internode were expressed as relative to the level of IN2 just prior constructing clusters using the Pearson correlation coefficient. [...] Real-time PCR analysis of 1045 transcription factor genes were carried out at the Genomics/Microarray core facility at the Samuel Roberts Noble Foundation. Quantitative real-time PCR (qRT-PCR) and the calculation of relative expression were performed as described previously []. In brief, cDNA samples prepared from the aforementioned five internodes were used for real time RT-PCR with technical duplicates. The 10 μl reaction included 2 μl of primers (0.5 μM of each primer), 5 μl of Power Sybr (Applied Biosystems, http://www.appliedbiosystems.com/absite/us/en/home.html), 2 μl 1:20 diluted cDNA from the reverse transcription step, and 1 μl of water. Real-time RT-PCR data were analyzed using SDS 2.2.1 (Applied Biosystems). The community high-throughput qRT-PCR uses a 384-well plate format with eight reference genes included on each plate. Information of primer sequences, accession numbers and stability test were described previously []. Transcript levels were determined by relative quantification using the Medicago Ubiquitin gene (TC102473, primers: UbiFw, GCAGATAGACACGCTGGGA; UbiRe, AACTCTTGGGCAGGCAATAA) as a reference. Amplification efficiency (E) was determined from three biological replicates of each of the five internode samples using LinRegPCR []. The relative expression of all internodes to internode 2 was calculated using the mean of three biological replicates for each organ. A TF gene was considered increased or decreased only if transcript levels for that gene were changed 5-fold or more than those of internode 2. […]

Pipeline specifications

Software tools Edge, LinRegPCR
Applications Gene expression microarray analysis, qPCR
Organisms Medicago truncatula, Homo sapiens, Arabidopsis thaliana
Chemicals Zinc