Computational protocol: Properties of Astragalus sp. microsymbionts and their putative role in plant growth promotion

Similar protocols

Protocol publication

[…] The bacterial strains were grown in 5 ml of YEM liquid medium at 28 °C for 2–3 days until they reached the stationary phase. Next, the rhizobia were centrifuged at 20,000×g for 10 min. Genomic DNA was isolated from the rhizobial strains using the GES method (Pitcher et al. ).To obtain the acdS gene sequences, the following set of degenerate primers was designed: primers acdSF (5′CAAGCTGCGCAAGCTCGAATA3′) and acdSR (5′CATCCCTTGCATCGATTTGC3′). The PCR assay was performed according to the manufacturer’s description using 25-μl of a reaction mixture (Sigma) under the following conditions: initial denaturation for 5 min at 95 °C, followed by 35 cycles of 30 s at 95 °C, 30 s at 50 °C, and 1 min at 72 °C, and final 5 min elongation at 72 °C. The PCR products were purified using a Clean-up kit (A&A Biotechnology) and sequencing reactions were performed using the BigDye Terminator Cycle Sequencing Kit (Applied Biosystems, USA). The products obtained were cleaned with an Ex-Terminator kit (A&A Biotechnology) and analysed in an automatic 3500 Genetic Analyzer sequencer (Applied Biosystems). The sequences of the acdS genes were compared with the sequences available in the GenBank and aligned using ClustalX2 multiple sequence alignment (Larkin et al. ). The phylogenetic tree of the acdS and AcdS sequences were constructed by MEGA 4.0 software (Tamura et al. ). The sequence similarity rate of the acdS sequence genes was determined according to the Kimura’s two-parameter model (Kimura ). The phylogenetic tree of the acdS gene sequences and deduced AcdS sequences were constructed using the neighbour-joining (NJ) method (Saitou and Nei ). […]

Pipeline specifications

Software tools Clustal W, MEGA
Application Phylogenetics
Chemicals Phosphates