Computational protocol: High nutrient availability reduces the diversity and stability of the equine caecal microbiota

Similar protocols

Protocol publication

[…] Samples collected 0, 4, and 9 hours post-feeding were analysed by FLX-pyrosequencing. Pyrosequencing was targeted to a variable region of V4 in 16S rDNA (). The primers used for PCR amplification were 5′-ACTGGGCGTAAAGCG-3′ and 5′-GGATTAGATACCCTGGTA-3′. Their 5′-ends were flanked by specific adaptors, 5′ CCATCTCATCCCTGCGTGTCTCCGACTCAG -3′ (forward) and 5′-CCTATCCCCTGTGTGCCTTGGCAGTCTCAG-3′ (reverse). The PCR products were titrated and pyrosequencing was performed with a Genome Junior Sequencer system (Roche Diagnostics, Mannheim, Germany) by the microbial laboratory facility of Nofima (Ås, Norway).Filtering analysis of sequencing data on each sample was conducted using OTUpipe available at the homepage of QIIME. OTUpipe is a pipeline script built using USEARCH (high-throughput biological sequence analysis) (www.drive5.com/usearch/) to perform filtering of noisy sequences, chimera checking (), and OTU picking (qiime.org/tutorials). […]

Pipeline specifications

Software tools Otupipe, QIIME, USEARCH
Application 16S rRNA-seq analysis
Organisms Equus caballus, Avena sativa
Diseases Acidosis