Computational protocol: Ruxolitinib/nilotinib cotreatment inhibits leukemia-propagating cells in Philadelphia chromosome-positive ALL

Similar protocols

Protocol publication

[…] To search for the potential molecular basis involved in LPC-mediated Ph+ALL progression, we performed RNA-Seq with the sorted LPCs and other cell fractions from the patients with de novo Ph+ALL (N = 2) to analyze their gene expression profiles. Total RNA was isolated from pellets using the RNeasy Mini Kit (Qiagen, Valencia, CA, USA). Three micrograms of RNA per sample was used as input material, and sequencing libraries were generated using the NEBNext Ultra RNA Library Prep Kit for Illumina (NEB, Ipswich, MA, USA). The library sequencing was performed on an Illumina HiSeq 2500 platform, and 125-bp paired-end reads were analyzed. Downstream analysis was performed using a combination of programs, including Bowtie2, Tophat2, HTseq, Cufflink and our wrapped scripts. The DESeq R package (1.10.1) was used to analyze the differential expression between the LPCs and other cell fractions. In all statistical analyses, P-values were analyzed using the Benjamini-corrected modified Fisher’s exact test, and a P < 0.05 was considered statistically significant.To confirm the RNA-Seq results, the relative JAK2 mRNA levels (forward primer: 5′-TCTGGGGAGTATGTTGCAGAA-3′; reverse primer: 5′-AGACATGGTTGGGTGGATACC-3′) between the LPCs and other cell fractions sorted from the patients with de novo Ph+ALL (N = 6) were analyzed using a SYBR green-based qRT-PCR technique. Normalized levels of the JAK2 ratios in the qRT-PCR assays were evaluated through comparisons with the GADPH levels (forward primer: 5′- GCACCGTCAAGGCTGAGAAC -3′; reverse primer: 5′- TGGTGAAGACGCCAGTGGA -3′). […]

Pipeline specifications

Software tools Bowtie2, TopHat, HTSeq, DESeq
Application RNA-seq analysis
Organisms Homo sapiens/Mus musculus xenograft, Mus musculus, Homo sapiens
Diseases Abetalipoproteinemia, Leukemia, X-Linked Combined Immunodeficiency Diseases, Precursor Cell Lymphoblastic Leukemia-Lymphoma