Computational protocol: Global Gene Expression Profiling Of Human Pleural Mesotheliomas: Identification of Matrix Metalloproteinase 14 (MMP-14) as Potential Tumour Target

Similar protocols

Protocol publication

[…] Microarray quality control and statistical validation were performed using Bioconductor . The presence of hybridization/construction artifacts was evaluated with the fitPLM function (Bioconductor package affyPLM). The probe (PM) intensity distribution was evaluated using hist function (Bioconductor package affy). Probe set intensities were obtained by means of GCRMA and normalization was done according to quantiles method . The number of genes evaluated was reduced by applying an interquartile (IQR) filter (24953 probe sets with IQR ≥0.25 were retained) followed by an intensity filter (17716 probe sets with expression signal ≥100 in at least 25% of the arrays were retained) to remove the non significant probe sets (i.e. those not expressed and those not changing) . Differential gene expression between MM and wild-type samples was detected using an empirical Bayes method together with a false discovery rate (FDR) correction of the P-value . Specifically, 470 probe sets (386 genes) were selected using a corrected p-value threshold of 0.05 and fold change threshold of |log2(fc)| ≥1. OneChannelGUI graphical interface package was used to run any of the described analysis . Ingenuity Pathway Analysis (Ingenuity Systems, http://www.ingenuity.com/) was used to functionally annotate genes according to biological processes and canonical pathways and to search for potential biomarkers. Hierarchical clustering analysis of the biomarkers expression data was done using Tmev (http://www.tm4.org/mev.html).Microarray data reported in the manuscript was described in accordance with MIAME guidelines. Microarray data were deposited on GEO database (http://www.ncbi.nlm.nih.gov/projects/geo/) as GSE12345 series. [...] Total RNA (2 µg) from normal and tumour samples was converted to cDNA using High- Capacity cDNA Reverse transcription kit (Applied Biosystem) under conditions described by the supplier. cDNA from this reaction was used directly in the qRT-PCR analysis. Gene specific primers for the selected genes (MMP14: Forward 5′ TCAAGGAGCGCTGGTTCTG, Reverse 5′ AGGGACGCCTCATCAAACAC; TOP2A: Forward 5′ TGCCAATGCTTCCAAGTTACAA, Reverse 5′TGTATGTCTGGGTCCATGTTCTG; MDK: Forward 5′ CAAAGGCCAAAGCCAAGAAA, Reverse 5′ GATTAAAGCTAACGAGCAGACAGAAG; AURKA: Forward 5′ CACCTTCGGCATCCTAATATTCTT, Reverse 5′ GGGCATTTGCCAATTCTGTT; TGFBR3: Forward 5′GCTGCCCAACTAAAAGGAAAAC, Reverse 5′ GAGGCTTTGCTCTGATTTCGA; EDG1: Forward 5′ GAGCGAGGCTGCGGTTT Reverse 5′ GGTGGTTCGATGAGTGATCCA) were designed using Primer Express 2.0 software (Applied Biosystems, Foster City, CA) and, when possible, the same coding target region identified by the Affymetrix probe was amplified; otherwise, primers were designed on the coding sequence. The specificity of each target amplicon was assessed by dissociation curve analysis and all amplicons were spanning over exon-exon regions to avoid genomic amplification. Quantitative PCRs were done on an ABI PRISM 7900HT Sequence Detection System (Applied Biosystems) in 96-well plates using a final volume of 20 µL and the following cycle conditions: 50°C for 2 minutes, 95°C for 10 minutes, and then 40 cycles of 15 seconds at 95°C and 1 minute at 60°C. All quantitative PCR mixtures contained 1 µL cDNA template (corresponding to 20 ng retrotranscribed total RNA), 1x Sybr Green PCR-Master-Mix (2x; Applied Biosystems) and 150 µmol/L of each target-specific primer. For each experiment, a no-template reaction was included as negative control. The expression of each target gene was evaluated by a relative quantification approach , using Glyceraldehyde 3-phosphate dehydrogenase (GAPDH: Forward 5′ GGAGTCAACGGATTTGGTCGTA, Reverse 5′ GAATTTGCCATGGGTGGAAT) as internal reference. Internal control was selected within not differentially expressed genes in this experiment. The Ct values of triplicate RT-PCR reactions were averaged for each gene in each cDNA sample. For each sample assayed, the level of gene expression for the corresponding gene of interest was calculated against that of the reference gene (GAPDH). Control sample were used as calibrator and each target genes was accepted as differential expressed when the ΔΔCt absolute value was >1, which correspond a 2-fold change in transcript abundance. The standard deviation was calculated for samples within each tissue group. […]

Pipeline specifications

Software tools affyPLM, oneChannelGUI, IPA, TM4, Primer Express
Applications Gene expression microarray analysis, qPCR
Organisms Homo sapiens