Computational protocol: Updating the Vibrio clades defined by multilocus sequence phylogeny: proposal of eight new clades, and the description of Vibrio tritonius sp. nov.

Similar protocols

Protocol publication

[…] The usual approach to compare trees is to count how many subtrees they share; a given subtree often has a different topology according to the method used (NJ, ML, or MP) but the differences are often subtle and generally not well-supported. Accordingly, it is best to compare trees according to bipartitions (a tree is considered as a set of bipartitions, each one corresponding to an internal edge of the tree, the external ones connecting the leaves to the tree) (Guénoche, ). This was the method used in this analysis to investigate whether the inclusion or exclusion of the 16S rRNA gene sequences in the MLSA analysis would, or would not, affect the final result. TreeDyn (Chevenet et al., ) was used to compare trees to subtrees sharing the same topology. A dedicated python script (using libraries from Huerta-Cepas et al., ) was used to compare trees with shared sub-trees, independently of their topologies.Our previous MLSA revealed that the 16S rRNA gene, in contrast to the other gene sequences used, has a rather low interspecies resolution (Sawabe et al., ). To increase the sensitivity and reduce the time taken by MLSA to update the vibrio phylogeny, we compared the subtree topologies obtained from a nine-gene data set (that included the 16S rRNA gene) and an eight-gene data set (that excluded the 16S rRNA gene). We used the gene sequence data set from the 58 species, for which we had the sequence of every gene, and which is identical to the data set used in Sawabe et al. (). The method selected, (1) shared subtrees only if they had the same topology, and (2) subtrees that shared the same species, independently of their topology. The results were visualized using TreeDyn (Chevenet et al., ), and congruent subtrees with the same topologies were indicated using the same color. [...] An additional eight housekeeping genes of type strains of the genera Vibrio and Photobacterium were sequenced manually according to Sawabe et al. () with newly designed primers (Vgap150f:ACTCAYGGYCGTTTCAACGGYAC, Vgap957r:RCCGATTTCGTTRTCGTACCAAG, VftsZf55f:GTKGGTGGCGGCGGCGGTAA, VftsZ782r:ACACCACGWGCACCAGCAA GATCG, VftsZ-9f:ACCGATGATGGAAATGTCTGACGATGC, VmreB225f:RATGAAA GACGGCGTWATYGC, VmreB1025r:TCGCCRCCGTGCATRTCGATCA) (Table ). All strains were maintained in ZoBell 2216E agar and stored with 20% glycerol at −80°C. Whole genome sequencing was performed in nine type strains (V. aerogenes LMG 19650T, V. gazogenes ATCC 29988T, V. halioticoli IAM 14596T, V. neonatus HDD3-1T, V. porteresiae MSSRF 30T, V. rhizosphaerae MSSRF 3T, V. ruber LMG 23124T, V. tritonius sp. nov. AM2T, and V. superstes G3-29T) using the Roche 454 FLX titanium genome sequencer alone or in combination with the Illumina MiSeq sequencer. The sequence reads were assembled using the Newbler software version 2.3 or later. Illumina reads were used only for sequence error correction. After auto-annotation by Microbial Genome Annotation Pipeline (MiGAP, http://www.migap.org/; Sugawara et al., ), relevant housekeeping gene sequences were retrieved and used for the MLSA. The house keeping genes necessary for updating the vibrio phylogeny were also retrieved from the latest version of the NCBI microbial genome and GenBank database (Release 197.0, 15 August 2013), and used in the analysis. All sequence data used in this study are listed in Table . [...] MLSA was performed the same way as in Sawabe et al. (). The sequences were aligned using the ClustalX program (Larkin et al., ). The domains used to construct the phylogenetic trees shown in Figures , were regions of the ftsZ, gapA, gyrB, mreB, pyrH, recA, rpoA, and topA genes of Vibrionaceae: positions 195–630, 225–861, 441–1026, 390–897, 171–543, 429–915, 87–873, and 570–990 (V. cholerae O1 Eltor N16961 (AE003852) numbering), respectively. The regions were within those used in the previous study (Sawabe et al., ). Sequence similarity and the number of nucleotide and amino acid mutation were determined using MEGA version 5 (Tamura et al., ).Split Decomposition Analysis (SDA) was also performed as described in Sawabe et al. () using SplitsTree version 4.12.8, with a neighbor net drawing and Jukes-Cantor correction (Bandelt and Dress, ; Huson and Bryant, ). The concatenated sequences of the eight housekeeping genes were also generated using the program and used for a phylogenetic analysis combined with NJ, MP, and ML analyses (Sawabe et al., ). [...] Four isolates of V. tritonius sp. nov., JCM 16456T = LMG 25401T = AM2T, JCM 16457 = LMG 25402 = MA12, JCM 16458 = LMG 25403 = MA17, and JCM 16459 = LMG 25404 = MA35, isolated from gut of a sea hare, Aplysia kurodai, were used in this study. The strains were cultured on ZoBell 2216E agar (Oppenheimer and ZoBell, ) and stored at −80°C in 10% glycerol-supplemented broth.A total of 1400 bp 16S rRNA gene sequences of the four strains were determined according to Sawabe et al. () using four sequence primers (24F, 1100F, 920R, and 1509R). The 16S rRNA gene sequences were blasted to the latest release ver. 197 of GenBank and related sequences were retrieved. Finally, 16S rRNA gene sequences of V. aerogenes X74705, V. brasiliensis AJ316172, V. cholerae X76337, V. fluvialis X74703, V. furnissii X76336, V. gazogenes X74705, V. hepatarius AJ345063, V. nereis X74716, V. porteresiae EF488079, V. rhizosphaerae DQ847123, V. ruber AF462458, V. tubiashii X74725, and V. xuii AJ316181 were included in the phylogenetic analysis (Figure ). Phylogenetic trees were constructed using three different methods (NJ, ML, and MP). For NJ analysis, distance matrices were calculated using the Kimura two parameters correction and using MEGA version 5.0 (Tamura et al., ). ML and MP analysis was conducted using PHYLIP (Phylogeny Inference Package, version 3.573c, distributed by J. Felsenstein, Department of Genetics, UW, Seattle, WA, USA). Sequences corresponding to positions 86–1420 of the E. coli gene (NC_000913) were used in this analysis. Figure represents a subset of the final tree obtained using the NJ method with 500 bootstrap replications. Nodes supported by ML and MP analyses are indicated by the bootstrap values in Figure .DNAs of bacterial strains were prepared following the procedures of Marmur (), with minor modifications. The mol% G+C content of DNAs was determined by HPLC (Tamaoka and Komagata, ). DNA-DNA hybridization experiments were performed in microdilution wells using a fluorometric direct binding method described by Ezaki et al. (); Ezaki et al. (). DNA-DNA similarity data were shown as the average value of triplicate experiments. V. brasiliensis, V. furnissii, V. fluvialis, V. tubiashii, V. hepatarius, V. mytili, V. nereis, V. porteresiae, and V. xuii were selected as the reference species of these DNA-DNA hybridization experiments, based on the results from the MLSA molecular phylogenetic assessment and the 16S rRNA gene phylogeny of V. tritonius sp. nov.A total of 62 phenotypic characteristics were determined using the standard manual characterization method established in our laboratory (Sawabe et al., ). The carbon assimilation test was conducted using a basal seawater medium, as previously described (Sawabe et al., ). These phenotypic characterizations were performed at 25°C. O/129 sensitivity was determined using the sensitivity basal agar medium (Nissui Pharmaceutical, Tokyo, Japan) at 30°C. […]

Pipeline specifications